ID: 1183186912

View in Genome Browser
Species Human (GRCh38)
Location 22:36297097-36297119
Sequence CTCGTTATGAAACGTGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 27}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183186910_1183186912 24 Left 1183186910 22:36297050-36297072 CCATGGGTTCTGTCTCCGTGTCA 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG 0: 1
1: 0
2: 1
3: 1
4: 27
1183186911_1183186912 9 Left 1183186911 22:36297065-36297087 CCGTGTCAATTACTTATACAAAA 0: 1
1: 0
2: 0
3: 40
4: 791
Right 1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG 0: 1
1: 0
2: 1
3: 1
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183186912 Original CRISPR CTCGTTATGAAACGTGTGTC AGG Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
914437971 1:147677178-147677200 ATTGTAATGAAACGTGTCTCTGG - Intergenic
920779651 1:208976243-208976265 CTCTTAATGGAAGGTGTGTCAGG - Intergenic
921583337 1:216921194-216921216 CTCCTGATGAAAGATGTGTCTGG - Intronic
1063204420 10:3817234-3817256 CTTGATATGACACATGTGTCAGG + Intergenic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1078126302 11:8567263-8567285 CTAGTTATGTAACGTTTATCTGG + Intronic
1087200489 11:95339763-95339785 CTCCTTATGAAACTTGTAACAGG + Intergenic
1087354828 11:97079333-97079355 CTCATTATGAAACTTCTGCCTGG - Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1109237582 13:59843566-59843588 CTCTTTATGAAATGTCTGTGAGG - Intronic
1124686468 15:31786882-31786904 CTCATTATGAAATGTGTGTGAGG + Intronic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1149127407 17:53252645-53252667 CTCGTTTTCAAACTTGTCTCAGG - Intergenic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1171176919 20:23058395-23058417 CTCTTTCTGAAACATGTATCTGG + Intergenic
1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG + Intronic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
950838995 3:15948751-15948773 CTGGTTATGAAACATGTGTCTGG - Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
956887649 3:73576628-73576650 CTCTTTAAGAAACTTGTGTTTGG - Intronic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
980658988 4:135831565-135831587 CTCCTTATAAAACATGTATCAGG - Intergenic
991351552 5:65724398-65724420 TTCGTTTTGAAGCATGTGTCGGG + Intronic
1018280971 6:162185053-162185075 ATCGTTATGAAACTTGTATTGGG + Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1060355918 9:122906805-122906827 CTCTTTATGAAACATATGCCAGG + Intergenic
1185814422 X:3141557-3141579 CTAGTTATAAAAATTGTGTCGGG - Intergenic