ID: 1183186972

View in Genome Browser
Species Human (GRCh38)
Location 22:36297647-36297669
Sequence ATGTGTAAGGACATTTGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183186966_1183186972 25 Left 1183186966 22:36297599-36297621 CCCATCACGTGATCTTGAGATGT 0: 1
1: 0
2: 0
3: 7
4: 64
Right 1183186972 22:36297647-36297669 ATGTGTAAGGACATTTGTCTAGG No data
1183186969_1183186972 0 Left 1183186969 22:36297624-36297646 CCCGTGAAGTTTCGCTGGAATAG 0: 1
1: 0
2: 2
3: 3
4: 82
Right 1183186972 22:36297647-36297669 ATGTGTAAGGACATTTGTCTAGG No data
1183186967_1183186972 24 Left 1183186967 22:36297600-36297622 CCATCACGTGATCTTGAGATGTA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1183186972 22:36297647-36297669 ATGTGTAAGGACATTTGTCTAGG No data
1183186965_1183186972 26 Left 1183186965 22:36297598-36297620 CCCCATCACGTGATCTTGAGATG No data
Right 1183186972 22:36297647-36297669 ATGTGTAAGGACATTTGTCTAGG No data
1183186970_1183186972 -1 Left 1183186970 22:36297625-36297647 CCGTGAAGTTTCGCTGGAATAGA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1183186972 22:36297647-36297669 ATGTGTAAGGACATTTGTCTAGG No data
1183186964_1183186972 29 Left 1183186964 22:36297595-36297617 CCACCCCATCACGTGATCTTGAG No data
Right 1183186972 22:36297647-36297669 ATGTGTAAGGACATTTGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183186972 Original CRISPR ATGTGTAAGGACATTTGTCT AGG Intronic
No off target data available for this crispr