ID: 1183188953

View in Genome Browser
Species Human (GRCh38)
Location 22:36309204-36309226
Sequence AGCTCGGCCCACTGTGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183188943_1183188953 22 Left 1183188943 22:36309159-36309181 CCACCTGGCCTATGTCAGGGGGC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1183188953 22:36309204-36309226 AGCTCGGCCCACTGTGGAGGTGG 0: 1
1: 0
2: 3
3: 23
4: 147
1183188948_1183188953 -10 Left 1183188948 22:36309191-36309213 CCCCTTGTTTGGCAGCTCGGCCC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1183188953 22:36309204-36309226 AGCTCGGCCCACTGTGGAGGTGG 0: 1
1: 0
2: 3
3: 23
4: 147
1183188944_1183188953 19 Left 1183188944 22:36309162-36309184 CCTGGCCTATGTCAGGGGGCACA 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1183188953 22:36309204-36309226 AGCTCGGCCCACTGTGGAGGTGG 0: 1
1: 0
2: 3
3: 23
4: 147
1183188945_1183188953 14 Left 1183188945 22:36309167-36309189 CCTATGTCAGGGGGCACATGTGT 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1183188953 22:36309204-36309226 AGCTCGGCCCACTGTGGAGGTGG 0: 1
1: 0
2: 3
3: 23
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183188953 Original CRISPR AGCTCGGCCCACTGTGGAGG TGG Intronic
900412338 1:2518423-2518445 AGGGCGGCCCAGGGTGGAGGTGG - Intronic
902938308 1:19780686-19780708 AGCTGAGCCCACTGCAGAGGGGG - Exonic
904470251 1:30731652-30731674 AGGTCGGCCCGCTGTGGGGCTGG - Intergenic
904623942 1:31791639-31791661 AGCTCGGCCCCCCGTGGCTGTGG + Intronic
906318996 1:44805271-44805293 AGATCTGCCCAGTGTGGAAGAGG + Exonic
910564321 1:88626107-88626129 ATCACGGTCCACTGTGGGGGTGG - Intergenic
911657781 1:100464230-100464252 AGCTCTGCCCACCCAGGAGGAGG - Intronic
912252624 1:108026988-108027010 TGCTCTGCCCACAGTGGGGGTGG + Intergenic
912833643 1:112976122-112976144 ATCTCGGCTCACTGTAGATGGGG - Intergenic
915315455 1:155026247-155026269 AGCTAAGCCCCCTGGGGAGGGGG + Intronic
915675307 1:157524389-157524411 ATCTCAGCCCCCTCTGGAGGAGG - Exonic
915676766 1:157539196-157539218 AGGTCGGCCAACTCTGCAGGAGG - Exonic
915690964 1:157690365-157690387 ATCTCGGCCCACTCTGGAGGAGG - Exonic
915691487 1:157695439-157695461 AGCTCAGCCCCCTCTGGAGGAGG - Exonic
915698327 1:157767341-157767363 AGCTCGGCCCCCTCTGGAGGAGG - Exonic
915701602 1:157802025-157802047 AGGTCGGCCCCCTCTGGAGGAGG - Exonic
918056113 1:181023147-181023169 AGCCCCGCCCACTGGGGGGGGGG - Intergenic
918423393 1:184386429-184386451 AGCTCGGGTCAGTATGGAGGCGG + Intergenic
918582325 1:186145791-186145813 TGCTCTGCCTCCTGTGGAGGAGG + Exonic
922912821 1:229231945-229231967 AGCTTGGCCCTCTGTGGGGCGGG + Intergenic
923678409 1:236099878-236099900 GGCTCAGCCCTCTGTGTAGGGGG - Intergenic
924034773 1:239924899-239924921 AGCCCTGCCCCCTGGGGAGGCGG + Intergenic
924378061 1:243433924-243433946 AGCTCTGCCGGGTGTGGAGGCGG - Intronic
1075422271 10:122310447-122310469 ACCTCTGCTCCCTGTGGAGGTGG + Intronic
1076291446 10:129349078-129349100 AGCTCAGCCCAGTGAGGAGGAGG + Intergenic
1076618997 10:131775098-131775120 AGCTCAGCCCACTGGGGCGTTGG - Intergenic
1076875886 10:133215322-133215344 AGCTCTGTCCACCGTGGAGGTGG - Intronic
1077018929 11:408944-408966 ACCACGGACCACTGTGGAGGTGG - Intronic
1077178678 11:1202771-1202793 AGCTGCGCCCAGAGTGGAGGCGG + Intergenic
1078509384 11:11974201-11974223 AGCTCTGCACACTGTGCAGGAGG + Intronic
1078581422 11:12542304-12542326 AGGGAGGCCCTCTGTGGAGGAGG + Intergenic
1084093486 11:66894667-66894689 CGTTCAGCCCATTGTGGAGGTGG - Intronic
1084510868 11:69602878-69602900 AGCTCGGCCTGCTGGGGAGGAGG - Intergenic
1085409396 11:76282388-76282410 AGCTCTGCCCACAGTGTGGGAGG + Intergenic
1089784589 11:120898893-120898915 AGCTGGGGCAACTGTGCAGGAGG + Intronic
1090715840 11:129430046-129430068 AGGGCTGCCCTCTGTGGAGGTGG - Intronic
1090932408 11:131310081-131310103 AGTTCAGCCCAGGGTGGAGGAGG + Intergenic
1091270307 11:134306656-134306678 AGCCAGGCCTACTGTAGAGGAGG + Intronic
1091766248 12:3121766-3121788 AGCACAGCCCCATGTGGAGGTGG - Intronic
1092499008 12:9027615-9027637 AGCTCTGGCCCCTGTGGTGGTGG - Intergenic
1092765181 12:11846668-11846690 AGCTAGTCCCACAGTGGGGGTGG - Intronic
1096255575 12:50059983-50060005 AGCCTGGCCCACAGAGGAGGAGG + Intronic
1101080135 12:101173376-101173398 ATCTCAGCCAGCTGTGGAGGTGG + Intronic
1101723882 12:107373941-107373963 AGCTCGGGACACGTTGGAGGCGG + Intronic
1101777589 12:107807967-107807989 AGCTGGGCTCAGTGTGGATGTGG + Intergenic
1103340115 12:120216625-120216647 AGCTCAGCCCACAGGGGTGGCGG + Intronic
1105498737 13:20953164-20953186 AGCTGGGCCTGCAGTGGAGGAGG + Intergenic
1105939939 13:25138856-25138878 AGATTGGCCCAGTGTGGTGGTGG - Intergenic
1106232169 13:27828976-27828998 AGCTCTGGCCCCTGTGGTGGTGG + Intergenic
1106765674 13:32911383-32911405 TTCACAGCCCACTGTGGAGGTGG + Intergenic
1107972743 13:45659861-45659883 AGCATGGCCCACAGTGGTGGGGG + Intergenic
1112321312 13:98410208-98410230 AGCCAGCCCCACCGTGGAGGAGG - Intronic
1113485692 13:110650829-110650851 GGCCCGGCCCACAGTGGATGTGG - Intronic
1113859229 13:113470635-113470657 AGCTGGGTCCCCTGTGGAGTTGG - Intronic
1113859298 13:113470907-113470929 AGCTGGGTCCCCTGTGGAGTTGG - Intronic
1113859340 13:113471060-113471082 AGCTGGGTCCCCTGTGGAGTTGG - Intronic
1118976826 14:70684992-70685014 AGTTCAGTCCACTGTGGATGAGG - Intergenic
1119264038 14:73253779-73253801 TGCTCAGCCTCCTGTGGAGGAGG + Exonic
1121963277 14:98280992-98281014 ACCTCTGCCCACTGAGGAGCTGG - Intergenic
1122227915 14:100290501-100290523 AGCTCTGCCCACTGACAAGGGGG - Intergenic
1122934934 14:104951562-104951584 GTCTCTGCCCAGTGTGGAGGTGG - Exonic
1124404869 15:29383681-29383703 GGTTCTGCCCCCTGTGGAGGTGG - Intronic
1132457913 16:34217-34239 TGCTGGGCCCACTGTGGGGGTGG + Intergenic
1133147572 16:3801190-3801212 TGGTCAGCCCTCTGTGGAGGAGG - Intronic
1134089398 16:11383635-11383657 AGCTTACCACACTGTGGAGGAGG + Exonic
1134096328 16:11421218-11421240 AGCTCTGCCCACTGGGGCTGGGG - Intronic
1134417599 16:14057973-14057995 AGCTCAGGTCACTGTGAAGGTGG - Intergenic
1134685832 16:16157557-16157579 AGGTGGGGACACTGTGGAGGTGG + Intronic
1136079860 16:27844861-27844883 AGCTCAGCCCAGTGGGGTGGGGG - Intronic
1136568095 16:31081729-31081751 AGGTGGGCACACAGTGGAGGGGG + Intronic
1139615271 16:68085041-68085063 AGCTCCGCCCAATGAGGAGAAGG + Intronic
1141124647 16:81392540-81392562 AACTCTGCCCACTCTGGAGTTGG + Intergenic
1143092283 17:4455903-4455925 AGCACTGCCCTCTGTGGGGGGGG + Intronic
1143558413 17:7676730-7676752 AGCTCGGCTTCCTGTGGAGCAGG + Intronic
1144110003 17:12021467-12021489 AGCGGGGCCCACTGCGGCGGCGG - Intronic
1147040366 17:37713700-37713722 AGGACGGCCCACTGTGGGGAGGG + Intronic
1147438727 17:40433775-40433797 AGCAGGGCCCACTGGGCAGGAGG + Intergenic
1147744593 17:42687542-42687564 AGCTCGTCCATCTGTGGAGGGGG - Intronic
1151820368 17:76493689-76493711 AGCTCCGGCCTCTGGGGAGGTGG - Intronic
1152781618 17:82229447-82229469 AGCTCGGTCCGCGGTGGCGGGGG + Intronic
1152961912 18:84900-84922 TGCTGGGCCCGCTGTGGGGGTGG + Intergenic
1154339395 18:13490780-13490802 AGCATGGCCCATTCTGGAGGAGG + Intronic
1154348402 18:13563387-13563409 AGCTTGGGCCACTGAGAAGGTGG + Intronic
1154356963 18:13628711-13628733 AGCTCTGCCCACTGTGGTTCAGG - Intronic
1156585125 18:38423607-38423629 AGCTCAGCCTACTGAGTAGGTGG + Intergenic
1159103659 18:63982050-63982072 AGCACGGTCCACAGGGGAGGAGG - Intronic
1160390174 18:78523994-78524016 AGCTCAGCCACCTGTGGACGCGG - Intergenic
1161146837 19:2683932-2683954 AGCTCGGCCCCCTGGGGCTGAGG - Intronic
1162141170 19:8586343-8586365 TGCTCGGCCCAGTGTGCAGGCGG - Exonic
1164581996 19:29440245-29440267 AGCCCTGCCCCCTGGGGAGGCGG - Intergenic
1167394410 19:49218644-49218666 AGTTTGGCCCACTATGGAGGTGG + Intergenic
1167586867 19:50380324-50380346 AGCTCGGTCCATTGTGAAGCGGG + Intronic
926675826 2:15619109-15619131 AGCTGGGCCCAGGGTGGTGGTGG - Intronic
927712004 2:25331934-25331956 AGCTCAGCCAACTGTGTGGGTGG - Intronic
933129499 2:78655231-78655253 AGCCCCGCCCAGTGGGGAGGGGG - Intergenic
933415837 2:81985384-81985406 AGCCCTGCCCTGTGTGGAGGCGG - Intergenic
935893059 2:107701039-107701061 AGATTGGCCCAGTGTGGTGGTGG - Intergenic
936043646 2:109169428-109169450 AGCTCAGCTCCCTGTGGTGGAGG + Intronic
940896834 2:159089123-159089145 AGCCCAGCCCACTGTGGAAGGGG - Intronic
942955325 2:181766382-181766404 AGCCAGGCCCACTCTGGAGAAGG + Intergenic
947654009 2:231810787-231810809 GACTCGGCCCCCTTTGGAGGTGG + Intergenic
947793571 2:232880880-232880902 GGCTGGGCCCACTGCGAAGGAGG + Intronic
947819636 2:233060928-233060950 AGCTCAGGGCTCTGTGGAGGTGG + Intronic
948838344 2:240636957-240636979 GGCTCGGGCCCCTGAGGAGGGGG - Intergenic
949027742 2:241774317-241774339 GCCTCGGCCCTCTGTGGACGTGG + Intergenic
1169012176 20:2259907-2259929 AGCTGGGCCCACTTTAGAGGAGG - Intergenic
1169336882 20:4763960-4763982 AACTTGTCCCACTGTGGATGAGG - Intergenic
1169715299 20:8609756-8609778 GCCTCGGCCCACTATGTAGGTGG + Intronic
1170904298 20:20498570-20498592 AGCCGGGCCCACTGAGGAGCAGG - Intronic
1171425588 20:25046700-25046722 AGCTGGGCCCACCGTGGCGAGGG + Intronic
1175156013 20:56972181-56972203 AGACAGGCCCACTGTGGAGTAGG + Intergenic
1181488591 22:23247257-23247279 GGCTCGGCCAGCTGTGGTGGAGG - Intronic
1181596346 22:23917383-23917405 AGCTCAGCCCGCTATGGATGGGG + Intergenic
1182150825 22:28026074-28026096 AGCCTGGCCTACAGTGGAGGTGG - Intronic
1183188953 22:36309204-36309226 AGCTCGGCCCACTGTGGAGGTGG + Intronic
1183283880 22:36950737-36950759 AGCTTAGCCCACTGTGCATGGGG + Intergenic
1185299416 22:50071859-50071881 AGCCCGGCCTGCTGGGGAGGGGG + Intronic
1185419791 22:50728886-50728908 ACTTTGGCCCACTGTGCAGGTGG + Intergenic
954317620 3:49809869-49809891 TGCCGGGCCCACTGTGGAGGAGG + Exonic
955194032 3:56788261-56788283 AGCTTGGCAGACTATGGAGGGGG - Intronic
955291114 3:57693042-57693064 GGCGCGGTCCGCTGTGGAGGCGG - Exonic
961494385 3:127280605-127280627 ACCTCTGCCCACTTTGGAGGGGG + Intergenic
965674313 3:171178983-171179005 AGGTCTGCACAATGTGGAGGGGG + Intronic
966981112 3:185136572-185136594 AGCTGGGCCCACAGTGGTGGCGG + Intronic
969057313 4:4409945-4409967 GGCTGGGCCCACTTTCGAGGAGG - Intronic
969608705 4:8215405-8215427 GGCTCATCCCACTGTGGACGTGG + Intronic
971227959 4:24772322-24772344 AGCTCTGGCCCCTGTGGTGGTGG + Intergenic
975794091 4:77987948-77987970 AGCTCTGGCCACTGTGGTGGTGG - Intergenic
982770171 4:159390186-159390208 AGCTCTGCCCCGTGGGGAGGTGG - Intergenic
984632749 4:182077863-182077885 GGCCCGTCCCACTGTGGATGGGG + Intergenic
984835597 4:184017159-184017181 AGCCCGGCCCATGGTGGAGCTGG + Exonic
985324723 4:188754724-188754746 AGCTCTGCCCTGTGGGGAGGCGG - Intergenic
985758407 5:1732723-1732745 GGCGGGGCCCACTGTGGAGCTGG + Intergenic
985763735 5:1765471-1765493 AGCACGGCCCACTGCACAGGTGG + Intergenic
991931396 5:71756378-71756400 GGCTCTGCCCCCTGTGCAGGCGG + Intergenic
997690507 5:135824747-135824769 AGATCTGCCCACTGAGAAGGAGG + Intergenic
998043281 5:138967092-138967114 AGCTGGACCCAGTATGGAGGAGG + Intronic
1001691118 5:173633275-173633297 AGCACAGCCCTCCGTGGAGGGGG - Intergenic
1006368140 6:33628054-33628076 AGCTTGGCCCACTGGGGCGGTGG + Intronic
1007415826 6:41690750-41690772 AGCTCGCACCCCTGGGGAGGCGG + Exonic
1019557754 7:1641119-1641141 AGCTCGGCTGAGAGTGGAGGGGG - Intergenic
1019697140 7:2452206-2452228 TGCTCGGCCACCTGTGGGGGAGG - Intergenic
1022955740 7:35378398-35378420 TCCTTGGCCCACTGTGGGGGTGG + Intergenic
1026003041 7:66577922-66577944 ACCTCAGCCTACTGTGTAGGTGG - Intergenic
1028134774 7:87213870-87213892 AGGGAGGCCCTCTGTGGAGGGGG - Intronic
1029605829 7:101598931-101598953 AGCTGGGCCCAGTGTGTGGGGGG - Intergenic
1030820558 7:114086670-114086692 AGCTCGGCCCAGCGTGGAGGTGG - Intronic
1034276491 7:149826151-149826173 TGCTCGGCCCCCTGTGGTGGGGG + Intergenic
1037308224 8:17528194-17528216 AGCTCCGTACACTGTCGAGGTGG + Intronic
1037538385 8:19848901-19848923 AGCTCAGCCCCCTTTTGAGGTGG - Intronic
1041453824 8:58035991-58036013 AGCCCGGGCCTCTATGGAGGAGG + Intronic
1049554052 8:143273538-143273560 AGCTTGGCCCACCATGGAGGGGG - Intronic
1049684038 8:143932126-143932148 GGCCCGGCCCACGGTGGAGGTGG - Exonic
1049748873 8:144274281-144274303 AGCTCTGCCCAGTGCCGAGGAGG + Intronic
1049812474 8:144581678-144581700 ACCCCGACCCAGTGTGGAGGTGG - Intronic
1050373254 9:4944758-4944780 AGCTCTGTCCCCTGTGGTGGTGG - Intergenic
1053624453 9:39854266-39854288 ATCTCCGGCCTCTGTGGAGGCGG - Intergenic
1053880416 9:42588961-42588983 ATCTCCGGCCTCTGTGGAGGCGG + Intergenic
1054219443 9:62396431-62396453 ATCTCCGGCCTCTGTGGAGGCGG + Intergenic
1054591623 9:67017847-67017869 ATCTCCGGCCTCTGTGGAGGCGG + Intergenic
1056475342 9:86947030-86947052 CGCTCGGCCCCCGGTGGTGGCGG + Exonic
1057217615 9:93238157-93238179 AGTTCCTCCCACTGTGGTGGAGG + Intronic
1057225233 9:93289467-93289489 AGCTGGGACCCCTGTGGAGGTGG + Exonic
1058699043 9:107586029-107586051 AGCTCCGACCACTGAGGAGAAGG - Intergenic
1062028925 9:134353217-134353239 AGCTCTCCCGGCTGTGGAGGAGG + Intronic
1062435380 9:136544666-136544688 AGAGCGGCCCATTGTGGAGTCGG + Intronic
1062530362 9:136996935-136996957 AGCTGGGTTCACGGTGGAGGTGG - Intergenic
1062736232 9:138139200-138139222 CGCTGGGCCCGCTGTGGGGGTGG - Intergenic
1187700969 X:21963975-21963997 TGGCCAGCCCACTGTGGAGGTGG - Intronic
1189309696 X:40010604-40010626 AGCTCAGCGCAGTGTGGGGGTGG - Intergenic
1190688504 X:52894733-52894755 GGCTCGGTCAACTGTGGGGGTGG + Intronic
1190697479 X:52961059-52961081 GGCTCGGTCAACTGTGGGGGTGG - Intronic
1196828315 X:119758193-119758215 AGCTCGGCCCGCTGCGGAAGGGG + Intergenic
1198394239 X:136206732-136206754 AGCTCGGGCCACTGTGGCCTGGG - Intronic