ID: 1183191131

View in Genome Browser
Species Human (GRCh38)
Location 22:36322669-36322691
Sequence CTCCAACCAAGGCCAGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 444}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183191121_1183191131 23 Left 1183191121 22:36322623-36322645 CCAACGTGCCAGGAACAGAGGTT 0: 1
1: 0
2: 0
3: 8
4: 191
Right 1183191131 22:36322669-36322691 CTCCAACCAAGGCCAGGCCCCGG 0: 1
1: 0
2: 3
3: 32
4: 444
1183191127_1183191131 -1 Left 1183191127 22:36322647-36322669 CCGGGTGGGCTCCAGTGTGCGAC 0: 1
1: 0
2: 1
3: 12
4: 117
Right 1183191131 22:36322669-36322691 CTCCAACCAAGGCCAGGCCCCGG 0: 1
1: 0
2: 3
3: 32
4: 444
1183191124_1183191131 15 Left 1183191124 22:36322631-36322653 CCAGGAACAGAGGTTTCCGGGTG 0: 1
1: 0
2: 1
3: 26
4: 232
Right 1183191131 22:36322669-36322691 CTCCAACCAAGGCCAGGCCCCGG 0: 1
1: 0
2: 3
3: 32
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183191131 Original CRISPR CTCCAACCAAGGCCAGGCCC CGG Intronic
900102121 1:966410-966432 CTCCACCCTCGCCCAGGCCCTGG + Intergenic
900485994 1:2923096-2923118 CCCCAACCCTGCCCAGGCCCTGG + Intergenic
901236284 1:7669370-7669392 CTGGAACCCAGGCCTGGCCCAGG - Intronic
901642324 1:10699005-10699027 CCCCAACCCAGGCCAGGCCATGG - Intronic
901649967 1:10737728-10737750 CACTCACCAAGGCCAGGGCCTGG + Intronic
901700559 1:11043059-11043081 CTCCGGCCCAGGCCAGACCCAGG - Intronic
901862172 1:12081366-12081388 CTCCAGCCAGCCCCAGGCCCAGG + Intronic
901869204 1:12127511-12127533 CTCAGCCTAAGGCCAGGCCCTGG + Intronic
902376035 1:16030297-16030319 CTCTCACCAAGCCCAGGCCTTGG + Intronic
902380974 1:16052042-16052064 CTCTCACCAAGCCCAGGCACTGG + Intronic
902615951 1:17623632-17623654 CTGCAACCTAGGGCAGGTCCAGG + Intronic
902633316 1:17718839-17718861 GTCCAACCAAGGCCTGGAGCAGG - Intergenic
903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG + Intronic
904093313 1:27959942-27959964 CGCCCACCAGGCCCAGGCCCCGG + Exonic
904412869 1:30335626-30335648 CACCATCCCAGGCCAGGTCCTGG + Intergenic
904413089 1:30336791-30336813 CTCCATCCAGGACGAGGCCCAGG - Intergenic
904496743 1:30891413-30891435 CTCCAGCCCAGGCCTAGCCCAGG - Intronic
904576029 1:31505561-31505583 CTCCGACCACGGCCAACCCCAGG - Intergenic
906035589 1:42748547-42748569 CTCCAACCAAGGGCAGATCCTGG + Intronic
906355390 1:45101877-45101899 CTCCACCCCACGACAGGCCCTGG - Intronic
906892616 1:49733799-49733821 CTACAACCAAAGCCAGGCAATGG + Intronic
906939618 1:50244736-50244758 CTCAATACAAGGCCTGGCCCCGG + Intergenic
906983870 1:50662054-50662076 CTCCAACACAGGCCAGCCCTGGG - Intronic
907053651 1:51345607-51345629 CTGCAGGCCAGGCCAGGCCCTGG + Intergenic
909212031 1:72836249-72836271 CTCCAACCCCTGACAGGCCCTGG - Intergenic
909369993 1:74872463-74872485 CTCAAACCCATGACAGGCCCCGG + Intergenic
909461218 1:75916673-75916695 CTCCACCCTCTGCCAGGCCCTGG - Intergenic
909879690 1:80858932-80858954 CCCCAACCCACGACAGGCCCCGG - Intergenic
910352784 1:86318775-86318797 CACCAACTAAGACCATGCCCTGG + Intergenic
911040773 1:93589083-93589105 CACCTCCCCAGGCCAGGCCCGGG - Exonic
911881950 1:103251220-103251242 CTCCACCCAACAACAGGCCCTGG - Intergenic
912245572 1:107958781-107958803 CTCCAACCCCCGACAGGCCCCGG + Intronic
912471331 1:109909112-109909134 CACCAACCCAGCCCTGGCCCAGG - Intergenic
912480203 1:109977370-109977392 CTTCATCCAAGCCTAGGCCCAGG - Intergenic
912584810 1:110752790-110752812 CCCCACCCCAGGACAGGCCCTGG + Intergenic
912666278 1:111582879-111582901 CTCCCACCTAGGCCAGAGCCTGG + Intronic
914426020 1:147577372-147577394 CTCCATCCAAGGCAAGCCCTTGG - Intronic
914825955 1:151138180-151138202 CCCCTACCTAGGCCTGGCCCTGG + Intronic
915178122 1:154034309-154034331 CTCCTACCAAGGCAAAGCCCAGG - Intronic
916347261 1:163807636-163807658 CAGTAACCAAGGCCAGACCCAGG + Intergenic
917267301 1:173234781-173234803 CTCCACCCCACGACAGGCCCCGG - Intergenic
917869557 1:179229488-179229510 CTCCCTCCCAGCCCAGGCCCTGG + Exonic
917977263 1:180248216-180248238 CTGCTAACCAGGCCAGGCCCTGG - Intronic
919002649 1:191853398-191853420 CCCCAACCCATGACAGGCCCTGG + Intergenic
919835543 1:201570658-201570680 CTACGACCAGGGCCAGGGCCAGG + Intergenic
920190683 1:204191763-204191785 CTCCTACCTCAGCCAGGCCCTGG - Intronic
920268317 1:204743534-204743556 CTCCTTCCAAGTCCAGGCTCTGG + Intergenic
922600198 1:226845337-226845359 CTCCAACAAGAGCAAGGCCCTGG + Intergenic
922742714 1:228023151-228023173 CTCCAACCATGGCCAGTGGCGGG + Intronic
923933358 1:238729305-238729327 CTCCACCCCATGACAGGCCCCGG - Intergenic
923954360 1:238997940-238997962 CTCCCCCCAAGGACAGGCCCAGG + Intergenic
924129827 1:240895441-240895463 CTCCACCCCATGACAGGCCCCGG + Intronic
924880514 1:248157038-248157060 CTCCACCCCATGACAGGCCCCGG + Intergenic
1064048721 10:12042521-12042543 CCCCAAGCATGGCCCGGCCCGGG + Intronic
1065502009 10:26391978-26392000 CTCCACCCCAGGCCAGATCCCGG - Intergenic
1065509461 10:26463896-26463918 CCCCAACCCCGGACAGGCCCTGG + Intronic
1066457972 10:35588030-35588052 CTCCACCCAACAGCAGGCCCAGG + Intergenic
1066975656 10:42365942-42365964 CCCCAACTCAGGACAGGCCCGGG + Intergenic
1067142705 10:43669881-43669903 GGCCAACCAAGCCCAGGCCAAGG - Intergenic
1067710169 10:48643590-48643612 CACCAACCCATGACAGGCCCTGG - Intronic
1068369025 10:56090087-56090109 CCCCAACCCAGGACAGGCCCTGG - Intergenic
1068373116 10:56144848-56144870 CTCCACCCCACGACAGGCCCTGG - Intergenic
1069049551 10:63778207-63778229 CTCCACCCCACGACAGGCCCCGG + Intergenic
1070919526 10:80175426-80175448 CTCCATCCACAGCCAGGCCAGGG + Intronic
1071149040 10:82611422-82611444 CTCCACCCCTGGACAGGCCCTGG + Intronic
1071513045 10:86278100-86278122 CTCCAACCAAAGACAGGGGCTGG + Intronic
1071697928 10:87897951-87897973 CCCCACCCCAGGACAGGCCCCGG + Intronic
1072415920 10:95246764-95246786 CCCCAAGCAAAGCCAGCCCCTGG + Intronic
1072720891 10:97780476-97780498 CTCCCACAAAGAGCAGGCCCTGG - Intergenic
1073381488 10:103081106-103081128 CTCCAAGCAAGAGCAGGCCAGGG + Exonic
1073652489 10:105376504-105376526 CTTCAGCCAAGATCAGGCCCAGG + Intergenic
1073936908 10:108643448-108643470 CTCCACCCTACGACAGGCCCCGG + Intergenic
1075779442 10:125007353-125007375 CTCTAAGCAATACCAGGCCCAGG - Intronic
1075898907 10:126022362-126022384 CTCCAGCCATGGCCAGGACATGG + Intronic
1076628035 10:131833874-131833896 CTGCAACCTTTGCCAGGCCCTGG - Intergenic
1076655659 10:132021884-132021906 TTCCCACCAAGGCCAGCGCCCGG - Intergenic
1076798940 10:132811833-132811855 CCCCACCCAAGTGCAGGCCCTGG + Intronic
1076851520 10:133095687-133095709 GTCCAGCCAAGACGAGGCCCTGG - Intronic
1077077257 11:707289-707311 TTCCAAACAAGGACAGGGCCAGG + Intronic
1077087987 11:764172-764194 CTCCCACCAGGGCCAGGCCTTGG - Intronic
1077192402 11:1260911-1260933 CTCCTAGCCAGGCCAGGGCCCGG + Intronic
1077235723 11:1481175-1481197 CTCCAACCAGGGAGGGGCCCAGG + Intronic
1077388246 11:2285844-2285866 GCCCAGCCAGGGCCAGGCCCTGG - Intergenic
1077607200 11:3620324-3620346 CTTCCTCAAAGGCCAGGCCCAGG - Intergenic
1077841046 11:5975155-5975177 CTCCTAGCAGGTCCAGGCCCAGG - Intergenic
1078549237 11:12269082-12269104 CCCCAACCCACACCAGGCCCTGG + Intergenic
1079444300 11:20545678-20545700 CTCCACAGAGGGCCAGGCCCTGG + Intergenic
1079828418 11:25229800-25229822 CTCCACCCCACGACAGGCCCTGG + Intergenic
1081651559 11:44827411-44827433 CCCTACCCAAGCCCAGGCCCAGG + Intronic
1082181799 11:49128916-49128938 CCCCACCCCAGGACAGGCCCTGG + Intergenic
1083944391 11:65915978-65916000 CCCCAATCAAGGCCAGGGCCAGG + Intergenic
1084110622 11:67012056-67012078 TTTCAACCAAGACCTGGCCCGGG - Intronic
1084153712 11:67302883-67302905 CTGCAGCCAAGCCCAGGCCCTGG + Intergenic
1084301811 11:68257209-68257231 CTCTAGCCAAGGCCAGCACCAGG + Intergenic
1084333165 11:68441486-68441508 CCCTAAACAAAGCCAGGCCCTGG - Intronic
1084662155 11:70552306-70552328 CTCCAGCCCAGGCCAAGCCTCGG + Intronic
1084787536 11:71452052-71452074 CTCCAGCCAAGGCCAGAGACAGG - Intronic
1084860709 11:72016056-72016078 CTCCAACCTCAGCCAGGCCAAGG - Exonic
1085036342 11:73302494-73302516 TTCCAAGAAAGGCCAGGCCCAGG + Intergenic
1085135550 11:74084280-74084302 CTCCACCCCATGACAGGCCCTGG - Intronic
1085368246 11:75973711-75973733 CCCCAACCCACGACAGGCCCTGG + Intronic
1086565196 11:88218348-88218370 CCCCAACCCATGACAGGCCCCGG + Intergenic
1087192848 11:95273982-95274004 CTCCACCCCACGACAGGCCCTGG - Intergenic
1087243896 11:95811417-95811439 CCCCAACCCACGACAGGCCCCGG - Intronic
1087916253 11:103814965-103814987 CTCCACCCCACGACAGGCCCTGG + Intergenic
1088619944 11:111671555-111671577 CTCCAATCACAGCCAGGCCAAGG - Intronic
1089253521 11:117181573-117181595 CTCCAGCCAAGGACTGGCCTAGG - Intronic
1090413918 11:126527838-126527860 CTCCCTCCAAGGCCAGGCTTGGG - Intronic
1091050973 11:132370849-132370871 CTCCACCCCATGACAGGCCCTGG - Intergenic
1091282648 11:134390846-134390868 CTCGAACCTGGGCCAGGCGCAGG + Exonic
1091297795 11:134486143-134486165 CTCCGCCCCATGCCAGGCCCTGG - Intergenic
1091323714 11:134668930-134668952 CCCCTACCCAGGCCAGCCCCAGG - Intergenic
1091632751 12:2174230-2174252 CTGCAACAAAGCCCAGGCACTGG - Intronic
1092171495 12:6376258-6376280 CTCCAACCTTGTCCAGACCCGGG + Intronic
1092226801 12:6753112-6753134 CCCGAACCTCGGCCAGGCCCGGG + Exonic
1092240526 12:6833544-6833566 CACCCACCAAGGTCAGCCCCTGG - Intronic
1092428155 12:8390183-8390205 CTTCAACCCAGGGCAGGCCACGG + Intergenic
1093021212 12:14206109-14206131 CTTCAACCAAGGCCAAGAACTGG + Intergenic
1094498921 12:31006328-31006350 CTCCAAGCAGGGGCAGGCCTAGG + Intergenic
1095990414 12:48030426-48030448 CACCCACTATGGCCAGGCCCTGG + Intergenic
1096155881 12:49341389-49341411 CTGCCATCACGGCCAGGCCCAGG + Intergenic
1097321082 12:58227093-58227115 CCCCACCCCAGGACAGGCCCTGG + Intergenic
1098978891 12:76933752-76933774 CCCCACCCAATGACAGGCCCCGG - Intergenic
1101628617 12:106471258-106471280 GACCAACCAAGCCCAGGCACAGG + Intronic
1102246986 12:111362188-111362210 CCCGGAGCAAGGCCAGGCCCAGG + Exonic
1103275040 12:119704334-119704356 GTTCAACCAAGGCAAGGCCCAGG + Intronic
1103445778 12:120994315-120994337 CCCCCCCCAGGGCCAGGCCCGGG + Exonic
1104028839 12:125049595-125049617 CTTCGACCAAGGCCAGTGCCGGG - Intergenic
1104226667 12:126841477-126841499 CTCCATCCACCCCCAGGCCCTGG - Intergenic
1105243013 13:18624462-18624484 CCCAAACCAAGGCAAGCCCCTGG + Intergenic
1105304379 13:19158673-19158695 TTCAAACCAGGGCCAGGCACGGG + Intergenic
1106021195 13:25917173-25917195 CTCCAACCCAGGCCAGGGCAGGG + Intronic
1106640413 13:31578815-31578837 CTCCACCCCATGACAGGCCCTGG + Intergenic
1106689877 13:32103493-32103515 CTCCACCCGACGACAGGCCCTGG - Intronic
1108804262 13:54134450-54134472 CTCCACCCCATGACAGGCCCGGG - Intergenic
1109807151 13:67457826-67457848 CCCCACCCCACGCCAGGCCCTGG - Intergenic
1110491124 13:76109303-76109325 CTCCAACCACTGACAGGCCCTGG + Intergenic
1110560294 13:76904589-76904611 CACACACCTAGGCCAGGCCCAGG + Intergenic
1110907571 13:80911824-80911846 CTCCAACCCCTGACAGGCCCTGG + Intergenic
1111329474 13:86745575-86745597 CTCCACCCATGGACAGGCCCCGG + Intergenic
1112135888 13:96577169-96577191 CTCCAACCCCTGACAGGCCCTGG + Intronic
1112269771 13:97958111-97958133 CTCCACCTGAGGCCAGGCCCTGG - Intronic
1113788387 13:113014915-113014937 CTCCAGCCTGGGCCAGGCCACGG - Intronic
1114434942 14:22698432-22698454 CTTCAACCATGTCCCGGCCCTGG + Intergenic
1114664064 14:24368301-24368323 CTCCCACCCAGGCCGGGACCTGG + Exonic
1116201022 14:41795763-41795785 CCCCAACCTACGACAGGCCCTGG - Intronic
1116673119 14:47869487-47869509 CTCCATCCCACGACAGGCCCCGG + Intergenic
1117098798 14:52324272-52324294 CTCCAATAAAGGCTTGGCCCAGG - Intronic
1117498848 14:56331926-56331948 ATCCAACCCAGGCCAGGGTCAGG + Intergenic
1117901453 14:60538135-60538157 CTCCACCCCACGACAGGCCCCGG + Intergenic
1118098004 14:62561145-62561167 CTCCACCCAACAACAGGCCCTGG - Intergenic
1118736686 14:68706050-68706072 CTCCAGCCAGGGCCTGGCTCTGG - Intronic
1120245751 14:82004175-82004197 CTCCACCCACCGACAGGCCCTGG + Intergenic
1120732456 14:88018897-88018919 CTCCAACCCCCGACAGGCCCCGG - Intergenic
1121456768 14:94043389-94043411 CTGGAGCCAGGGCCAGGCCCAGG + Intronic
1121904750 14:97729397-97729419 CTCCACCCCACGACAGGCCCTGG + Intergenic
1122068197 14:99188520-99188542 CTCCAACCAATGGCTGGCCTGGG + Intronic
1122442816 14:101744388-101744410 CTCCACCCCACGACAGGCCCTGG + Intergenic
1122847787 14:104510262-104510284 CTCCCGCCAAGGTCAGGCTCAGG + Intronic
1122858630 14:104572184-104572206 CTCTGAGCAAGGTCAGGCCCTGG + Intronic
1122987892 14:105221045-105221067 CTCACACAGAGGCCAGGCCCTGG + Intronic
1123035938 14:105471985-105472007 CTCCAGAAAAGGACAGGCCCTGG - Intergenic
1123488279 15:20760169-20760191 CCCCAACCAAGGCAAGCCCCTGG - Intergenic
1123544777 15:21329242-21329264 CCCCAACCAAGGCAAGCCCCTGG - Intergenic
1125454700 15:39845136-39845158 TTCCTACCTAGGCCAGGCCCAGG + Intronic
1125471711 15:40010932-40010954 CCCTAACAAAGGCCAGGCTCTGG - Intronic
1126198061 15:45953899-45953921 CTCCACCCACTGACAGGCCCTGG + Intergenic
1127167862 15:56266480-56266502 CCCCACCCAATGACAGGCCCCGG + Intronic
1127205221 15:56709845-56709867 CCCCACCCAACGACAGGCCCCGG - Intronic
1127726920 15:61759452-61759474 CTCAGACCATGGCCAAGCCCGGG + Intergenic
1128090556 15:64916087-64916109 CCCCACCCAAGGTCAGGACCAGG + Intronic
1128697142 15:69775020-69775042 CTCCACCCCACGACAGGCCCCGG - Intergenic
1129522130 15:76192598-76192620 GCCCAAACAAGTCCAGGCCCGGG + Intronic
1129663395 15:77565806-77565828 CTCCAACCAGAGCCACGTCCTGG + Intergenic
1129691725 15:77717703-77717725 CCCCCACCAAGCCCAGGCCCGGG + Intronic
1129743844 15:78004288-78004310 TCCTAACCATGGCCAGGCCCTGG + Intronic
1130302184 15:82688691-82688713 CGCCAACGAGGCCCAGGCCCTGG + Intronic
1131215335 15:90530681-90530703 GTCCATCCAGGGCCCGGCCCTGG + Intronic
1131848893 15:96516839-96516861 CTCCACCCCAAGACAGGCCCCGG + Intergenic
1131887632 15:96935009-96935031 CTCCACCCCATGACAGGCCCTGG + Intergenic
1132253951 15:100357759-100357781 CTCCACCCACTGACAGGCCCTGG - Intergenic
1202953122 15_KI270727v1_random:56513-56535 CCCCAACCAAGGCAAGCCCCTGG - Intergenic
1132467792 16:85534-85556 CTCCAAGCTGTGCCAGGCCCTGG + Exonic
1132476755 16:143135-143157 ATCCTGCCAAGGGCAGGCCCAGG - Intergenic
1132585651 16:704964-704986 CTCCAACCTTGGCCAAGGCCCGG + Intronic
1133064866 16:3198544-3198566 GTCCAACATAGACCAGGCCCAGG - Intergenic
1133478315 16:6145191-6145213 CTCCACCCTAGGAAAGGCCCTGG + Intronic
1133656892 16:7873648-7873670 CTCCACCCCATGACAGGCCCCGG + Intergenic
1134135415 16:11673721-11673743 CTCCTACCAGGCCCTGGCCCAGG - Intronic
1137675256 16:50300908-50300930 CTCCATCCACAGCCAGCCCCAGG - Intronic
1137984171 16:53093904-53093926 ATCGAACCAAAGCCAGTCCCTGG - Intronic
1138623508 16:58230747-58230769 CTCAAATCTGGGCCAGGCCCAGG - Intergenic
1139364559 16:66425893-66425915 CTCCCTGCAAGGCCAGTCCCTGG + Intergenic
1139563845 16:67760569-67760591 CTCCCACAAAGGCCAGGGCCTGG + Intronic
1140519966 16:75572434-75572456 CCCCAACCAAGGGCAGGTCATGG - Intronic
1140739079 16:77925274-77925296 CTGCAACCAGGGCCAGGACTAGG - Intronic
1141442892 16:84040887-84040909 ATCCATCCTAGGCCAGGCACGGG + Intronic
1141499889 16:84436662-84436684 CTCCACCCGAGGCCAGGCTGAGG - Intronic
1142396920 16:89837330-89837352 CTGGAGCCAAGGCTAGGCCCAGG + Intronic
1143548988 17:7617311-7617333 TTGCAACCATGGCCAGGCACAGG + Intronic
1143908570 17:10228899-10228921 CTCCACCCTAGTCCTGGCCCTGG + Intergenic
1144355421 17:14441309-14441331 CTCCACCCCACGACAGGCCCCGG + Intergenic
1146110958 17:30089094-30089116 CTCCACCCCACGACAGGCCCCGG + Intronic
1146242522 17:31243720-31243742 CTCTAACCCAGGGCAGGTCCAGG + Intronic
1146267309 17:31461248-31461270 CTGAGTCCAAGGCCAGGCCCAGG - Intronic
1147186598 17:38716569-38716591 CTCCAGCTCAGGCCGGGCCCGGG + Exonic
1147310213 17:39591595-39591617 CCCCAGCAAAGGGCAGGCCCTGG - Intergenic
1147918002 17:43900189-43900211 CTCTGACCAATGCCAAGCCCCGG - Intronic
1149064182 17:52460572-52460594 CCCCACCCCACGCCAGGCCCCGG - Intergenic
1150255268 17:63739878-63739900 CTCCGACGAAGGCCCGGGCCTGG + Intronic
1150255553 17:63741645-63741667 CTCCGACGAAGGCCCGGGCCTGG + Intronic
1150643321 17:66964091-66964113 CTGCAAGCCACGCCAGGCCCGGG - Intergenic
1150895651 17:69207740-69207762 CTCCACCCACTGCCAGGCCCTGG - Intronic
1151509788 17:74551133-74551155 CTCCAGCCACTGCCATGCCCAGG - Intergenic
1151560732 17:74868161-74868183 CTCCATCCCAGGCCAGCCACAGG + Intronic
1152756537 17:82089378-82089400 CTCCCACGATGTCCAGGCCCCGG - Exonic
1152877191 17:82793611-82793633 CTCCAGGAAAGGCCTGGCCCTGG + Intronic
1152945036 17:83193561-83193583 CACCCACCCAGGCCAGGGCCAGG - Intergenic
1153368604 18:4287670-4287692 CTCCACCCCATGACAGGCCCTGG - Intronic
1153946605 18:10023566-10023588 AACCAACCCAGGCCAGGCCAGGG + Intergenic
1154192956 18:12245699-12245721 CTCAAACCACGGCCATGCCAGGG + Intergenic
1154445924 18:14435435-14435457 CCCAAACCAAGGCAAGCCCCTGG - Intergenic
1155831177 18:30516377-30516399 CTCCACCCCATGACAGGCCCTGG - Intergenic
1156256636 18:35404151-35404173 CTCCACCCCATGACAGGCCCTGG + Intergenic
1157112226 18:44832312-44832334 CAGCATCCCAGGCCAGGCCCGGG + Intronic
1157252189 18:46104635-46104657 ATCCAAACAAGGGGAGGCCCGGG - Intronic
1158544057 18:58380727-58380749 CTCCACCCCATGACAGGCCCCGG + Intronic
1160884167 19:1337359-1337381 CACCAACCACGGTCAAGCCCAGG - Intergenic
1160932157 19:1575894-1575916 CTCAGACCAAGGCCAGGACATGG + Intronic
1161171257 19:2813492-2813514 GTGCAACAAAGACCAGGCCCTGG - Exonic
1161398882 19:4059007-4059029 CCCCACCCAAGGCTCGGCCCTGG + Intronic
1161401414 19:4067445-4067467 CCCCCCGCAAGGCCAGGCCCTGG + Intergenic
1161574585 19:5048565-5048587 CTCCAACCCAGGGAAGGGCCAGG - Intronic
1161576741 19:5058562-5058584 CTCCCACCACACCCAGGCCCTGG - Intronic
1162145873 19:8611670-8611692 CAGAGACCAAGGCCAGGCCCAGG - Intergenic
1162781127 19:13007499-13007521 CTCTGCCCAAGCCCAGGCCCTGG + Intronic
1163074042 19:14872547-14872569 CTCCACCCACCGACAGGCCCCGG - Intergenic
1163262980 19:16202330-16202352 CTCCAACCGCAGCCATGCCCAGG + Intronic
1163265427 19:16217817-16217839 CTCCAGCCTAAGCCAGGCCAGGG - Intronic
1165060901 19:33204806-33204828 CTCCAGCTCCGGCCAGGCCCAGG + Exonic
1165271470 19:34711493-34711515 CTCCCACCAAGGCCTTTCCCTGG + Intergenic
1166412900 19:42568516-42568538 CTCCACCCCACGACAGGCCCCGG - Intergenic
1166423495 19:42655923-42655945 CTACAACCCAGGCCTGGCACAGG - Intronic
1167158046 19:47751036-47751058 CTGCAACAAGGGCCAAGCCCGGG + Exonic
925365896 2:3311946-3311968 TTCCAAAGAAGGCCAGGTCCAGG - Intronic
925878564 2:8332001-8332023 CACCGAGCAAGGCCAGGCCCAGG + Intergenic
925942229 2:8831548-8831570 CCCCAAGCTGGGCCAGGCCCTGG + Intronic
926330707 2:11822897-11822919 CTCCACCCTAGGCCAAGCCATGG - Intronic
927249066 2:20981871-20981893 CTCCAACCAGGCCCAGGTCCAGG - Intergenic
928536851 2:32249441-32249463 CTCCAACCAAGACCAGAGACAGG - Intronic
931201936 2:60106060-60106082 CTCCACCCACGCCCACGCCCAGG + Intergenic
931558096 2:63527373-63527395 CCCCAACCAACGACAGGCCCTGG + Intronic
931699282 2:64896918-64896940 CCCCACCCCAGGACAGGCCCCGG - Intergenic
931835501 2:66094688-66094710 CCCCACCCCAGGACAGGCCCTGG + Intergenic
933020452 2:77183919-77183941 CCCCAACCCACGACAGGCCCCGG - Intronic
934555750 2:95286324-95286346 CCCAAACCAAGATCAGGCCCTGG + Intronic
934617613 2:95784444-95784466 CTCCACCCACCGACAGGCCCTGG - Intergenic
934643280 2:96040115-96040137 CTCCACCCACCGACAGGCCCTGG + Intergenic
935366470 2:102296689-102296711 CTCCAACCAACTGCAGGTCCTGG + Intergenic
937232056 2:120403972-120403994 CTCCTCCCTATGCCAGGCCCCGG + Intergenic
938106375 2:128533397-128533419 CTCCAACCATGGCCAAGAACAGG - Intergenic
938159452 2:128972669-128972691 GTCCACTCAAGGCCAGGGCCAGG - Intergenic
938897392 2:135765770-135765792 CTCCATCCTAGGCCAGGATCTGG + Intronic
940043943 2:149389728-149389750 CTCCACTCAAGGCCTGGCTCAGG - Intronic
943217513 2:185057852-185057874 CCCCAACCCATGACAGGCCCTGG + Intergenic
944156489 2:196612527-196612549 CTGCAGCCCATGCCAGGCCCTGG - Intergenic
944520444 2:200561198-200561220 CCCCACCCAACGACAGGCCCTGG + Intronic
944549215 2:200830155-200830177 CCCCAACCCACGACAGGCCCCGG - Intergenic
945441914 2:209889646-209889668 CGCCACCCACGGACAGGCCCCGG + Intronic
947461153 2:230306038-230306060 CTCCAGCCCTTGCCAGGCCCAGG - Intronic
947635916 2:231680824-231680846 CACCAGCCACGGCCAGGCCCAGG + Intergenic
947748648 2:232522052-232522074 CACCAGCCAGGGCCAGGCCCCGG - Exonic
947913074 2:233814337-233814359 CTTCATCCAGGGCCAAGCCCTGG - Intronic
948799207 2:240423747-240423769 CTCCAACCAGCGACAGTCCCTGG + Intergenic
949031375 2:241798977-241798999 CTGCAGCCAAGTCCAGGCCTTGG - Intronic
949059169 2:241946873-241946895 GTCCAGCCAAGGGCAGCCCCAGG - Intergenic
1169843589 20:9965855-9965877 CTCCTACCATGGCAAGTCCCGGG - Intergenic
1170487023 20:16828783-16828805 CTGCAAGCAATGGCAGGCCCAGG - Intergenic
1171171226 20:23017218-23017240 TTTCAACTAAGGGCAGGCCCTGG - Intergenic
1171244885 20:23603119-23603141 CTCCAAGCAAAGCCTGGCTCTGG - Exonic
1171337386 20:24396639-24396661 CTCCACCCCATGACAGGCCCTGG + Intergenic
1172455732 20:35071435-35071457 CCCCACCCCATGCCAGGCCCTGG + Intronic
1173481269 20:43401583-43401605 CTCCACCCCACGACAGGCCCCGG + Intergenic
1173803219 20:45907944-45907966 CTCCACCCCAGTCCAGGTCCAGG + Intronic
1174423619 20:50416697-50416719 AGCCAAGCAAGGCCAGACCCTGG + Intergenic
1175116481 20:56686074-56686096 CTCCAACCAAAAGCTGGCCCGGG + Intergenic
1175509567 20:59514778-59514800 TACCATCCAAGGCCAGGGCCAGG + Intergenic
1175968013 20:62669304-62669326 CTCCAGCAAAGCCCAGGCCCAGG + Intronic
1176029751 20:63006204-63006226 CCTCAACCAGGGCCAGGGCCTGG - Exonic
1176059312 20:63165377-63165399 CTCCCATGAGGGCCAGGCCCAGG - Intergenic
1176270783 20:64234799-64234821 CACCCACCATGGCCAGCCCCGGG - Intronic
1176270935 20:64235274-64235296 CACCCACCATGGCCAGCCCCGGG - Intronic
1176271032 20:64235581-64235603 CACCCACCATGGCCAGCCCCGGG - Intronic
1176450055 21:6854422-6854444 CCCAAACCAAGGCAAGCCCCTGG + Intergenic
1176828224 21:13719440-13719462 CCCAAACCAAGGCAAGCCCCTGG + Intergenic
1177045291 21:16161333-16161355 CTCCACCCCACGACAGGCCCCGG + Intergenic
1181119279 22:20654768-20654790 TGCCAACCCAGGCCAGGGCCTGG + Intergenic
1181478224 22:23181325-23181347 CTCCGGGTAAGGCCAGGCCCGGG + Exonic
1181897830 22:26126376-26126398 CACCCAGGAAGGCCAGGCCCTGG + Intergenic
1182485102 22:30634816-30634838 TTCCAGGCTAGGCCAGGCCCTGG - Intergenic
1182547933 22:31086267-31086289 CTTCAGCCTAGGGCAGGCCCTGG + Intronic
1182804342 22:33057961-33057983 CTCCACCCAGCGCCCGGCCCGGG - Intronic
1183191131 22:36322669-36322691 CTCCAACCAAGGCCAGGCCCCGG + Intronic
1183467442 22:37986806-37986828 CTCCATCCCATCCCAGGCCCTGG + Intronic
1184380803 22:44143818-44143840 CTCCAGCCCAGGGCAGGCCCAGG - Intronic
1184727194 22:46354016-46354038 CTGCCACCATGGCCAGTCCCAGG - Intronic
1185058034 22:48591461-48591483 CTCCATCCAGGGCAAGGCCATGG - Intronic
1185173239 22:49305386-49305408 GTCCACCCCAGGCCAGACCCAGG - Intergenic
1185198992 22:49490735-49490757 CTCCAACCACGTCCAGCACCAGG - Intronic
1185274533 22:49944605-49944627 CTCAGACCAAGGCCAGGTCCAGG - Intergenic
1185314706 22:50174069-50174091 CCTCAGCCGAGGCCAGGCCCTGG - Intronic
1185384917 22:50527182-50527204 CCCCAACCAGGAGCAGGCCCGGG - Exonic
949248740 3:1957427-1957449 CCCCACCCCAGGACAGGCCCCGG + Intergenic
949687511 3:6592742-6592764 CCCCAACCAAGGACAGGCCCCGG - Intergenic
950270473 3:11610603-11610625 CTCAAACCAAGCCCAGTCCAGGG - Intronic
953195968 3:40733497-40733519 CCCCACCCAACGACAGGCCCCGG - Intergenic
954367503 3:50154508-50154530 CTCCAGCCTAGGCCAGGTCGGGG - Intergenic
954786543 3:53097290-53097312 CTCAGACCAGGGCCAGGCGCTGG + Intronic
954828517 3:53397565-53397587 CCCCAGCCCAGGACAGGCCCTGG + Intergenic
958061938 3:88494898-88494920 CCCCACCCCAGGACAGGCCCTGG + Intergenic
958105588 3:89068762-89068784 CTCCAACCCACAACAGGCCCCGG + Intergenic
961191685 3:124967782-124967804 CTCCTACCATGACCAGGCTCTGG - Exonic
961748219 3:129079476-129079498 ATACAACCAAGGCCAGAGCCTGG + Intergenic
962022644 3:131516111-131516133 CTCCACCCTACGACAGGCCCCGG - Intergenic
962226459 3:133614814-133614836 CCCCACCCCAGGACAGGCCCCGG - Intronic
963632055 3:147745744-147745766 CTCCACCCTATGACAGGCCCCGG - Intergenic
964396528 3:156251594-156251616 CTCCTCCCAAGCCCAGACCCAGG - Intronic
964896577 3:161603636-161603658 CCCCACCCAACGACAGGCCCCGG + Intergenic
965966301 3:174494461-174494483 CCCCACCCCAGGACAGGCCCCGG - Intronic
968293229 3:197555071-197555093 CTCCCACCCTGGCCAGTCCCGGG + Intronic
968516904 4:1019267-1019289 CTCCCACCCAGGACAGGGCCAGG + Intronic
968531258 4:1092971-1092993 CTCCAAACTACGCCAGGACCAGG + Intronic
969427014 4:7130347-7130369 CTCCTTCCAGGCCCAGGCCCGGG + Intergenic
970094453 4:12446317-12446339 TTCCAAACAAGTCCAGACCCCGG - Intergenic
970496695 4:16633274-16633296 CTCCACCCCATGACAGGCCCTGG - Intronic
971327815 4:25658444-25658466 CTCCAACCAAGACCTGTTCCTGG - Intronic
975052243 4:69880301-69880323 TTCCTACCAAAGCCAGTCCCTGG - Intergenic
976790797 4:88876128-88876150 CCCCATCCCAGGACAGGCCCTGG - Intronic
977813216 4:101383145-101383167 CTCCACCCACCGACAGGCCCCGG + Intergenic
979042665 4:115817645-115817667 CCCCAACCCATGACAGGCCCTGG - Intergenic
979088022 4:116439992-116440014 CTCCACCCACTGACAGGCCCCGG - Intergenic
979122973 4:116926446-116926468 CTGCAGCCAAGGACAGGCCTGGG + Intergenic
979899055 4:126194598-126194620 CTCCATCCAACAACAGGCCCTGG + Intergenic
980235055 4:130094643-130094665 CTCAAACCAAGGCAAGGGCATGG - Intergenic
981050038 4:140300661-140300683 TTCAAGCCAAGCCCAGGCCCAGG + Intronic
981346132 4:143678378-143678400 CCCCAACCAACAACAGGCCCCGG - Intronic
982525057 4:156467389-156467411 CCCCACCCGAGGGCAGGCCCCGG + Intergenic
983464518 4:168070244-168070266 CCCCAACCCACGACAGGCCCTGG - Intergenic
985243578 4:187956914-187956936 CTCCACCCGACGACAGGCCCCGG - Intergenic
985525315 5:398601-398623 CTTCCACCAGGGGCAGGCCCAGG - Intronic
985592704 5:773785-773807 CTCCAAGCAGGTCCTGGCCCTGG - Intergenic
986576925 5:9222058-9222080 CTCCCACCAAATCCAGCCCCAGG - Intronic
986787393 5:11127059-11127081 CTCCAACCAAGGACAGGACCTGG + Intronic
987973117 5:24976859-24976881 CCCCAACCCACGACAGGCCCCGG + Intergenic
988152282 5:27399797-27399819 CCCCATCCCAGGACAGGCCCCGG - Intergenic
988384462 5:30543018-30543040 CTCCAAGCAAGGAAATGCCCAGG + Intergenic
988843903 5:35110204-35110226 CCCCATCCAATGACAGGCCCTGG - Intronic
990154764 5:52863455-52863477 CCCCAACCTAGGGAAGGCCCTGG - Intronic
990839029 5:60054518-60054540 CTCCACCCACCGACAGGCCCTGG - Intronic
992747688 5:79835443-79835465 CCGCAACCAAGCTCAGGCCCCGG - Intergenic
992862959 5:80930527-80930549 CTCCACCCAAGACGAGCCCCAGG - Intergenic
993689025 5:90975690-90975712 CTCGACCCCAGGACAGGCCCCGG - Intronic
993888842 5:93448036-93448058 CTCCACCCCACGACAGGCCCTGG - Intergenic
995529721 5:113080640-113080662 CTCCACCCCACGACAGGCCCCGG - Intronic
995993788 5:118274430-118274452 CCCCAACCCACGACAGGCCCTGG - Intergenic
997146605 5:131440918-131440940 CACCAAACTAGTCCAGGCCCTGG + Intronic
1000423894 5:161068334-161068356 CCCCACCCCAGGACAGGCCCTGG + Intergenic
1000516877 5:162247966-162247988 CTGCAACGAAGTCCAGACCCAGG - Intergenic
1001545529 5:172568469-172568491 ATCCACCCTGGGCCAGGCCCAGG - Intergenic
1001999250 5:176188275-176188297 CTCCTGCCAAGGCCAGAGCCTGG + Intergenic
1002602904 5:180364175-180364197 CTCTAAACACTGCCAGGCCCAGG - Intergenic
1004495505 6:16159293-16159315 CTACAAACAAGCCCTGGCCCTGG + Intergenic
1004946339 6:20617571-20617593 CTCCACCCCATGACAGGCCCTGG + Intronic
1005023273 6:21437960-21437982 CTGCAACCAAAGCCAGGGCATGG + Intergenic
1005222067 6:23598221-23598243 CCCCACCCCAGGACAGGCCCCGG - Intergenic
1006079708 6:31558289-31558311 AGCCAACCAGGGCCGGGCCCAGG + Exonic
1006511537 6:34524156-34524178 GTCCAGAAAAGGCCAGGCCCAGG - Intronic
1009483713 6:64193654-64193676 CCCCACCCAATGACAGGCCCTGG + Intronic
1011072757 6:83403655-83403677 CTCCACCCCACGACAGGCCCTGG + Intronic
1011472427 6:87721310-87721332 CTCCTAACAACCCCAGGCCCTGG - Intergenic
1012489399 6:99764200-99764222 CGCCACCCCAGGACAGGCCCCGG + Intergenic
1012744298 6:103064785-103064807 CCCCATCCCAGGACAGGCCCCGG + Intergenic
1012888727 6:104875101-104875123 CTCCACCCCACGACAGGCCCCGG - Intergenic
1013053830 6:106563814-106563836 CTCCAAGCTAGGCCTGGCCCTGG + Exonic
1014129629 6:117816048-117816070 CTCCACCCCATGACAGGCCCTGG + Intergenic
1015724609 6:136287738-136287760 ATTCAACCGAGGCCAGGCGCAGG + Intronic
1017887304 6:158609792-158609814 CTGTATGCAAGGCCAGGCCCAGG + Intronic
1018552703 6:165016594-165016616 CTCCACCCCATGACAGGCCCCGG + Intergenic
1018815188 6:167325197-167325219 CTCCACACAAAGCCAGGCGCTGG + Exonic
1019289942 7:245481-245503 CGTCCACCCAGGCCAGGCCCAGG - Intronic
1019949474 7:4359723-4359745 CTCCACCCCATGACAGGCCCTGG - Intergenic
1020741271 7:12021803-12021825 CACCAACCAAGGTTAGGCTCAGG + Intergenic
1021391028 7:20092878-20092900 CTCCACCCCATGACAGGCCCCGG - Intergenic
1022094399 7:27130060-27130082 CTCGAACCCAGGCCCAGCCCCGG + Intronic
1024640856 7:51327379-51327401 CTCCCACCAAGGCAAGGCAATGG + Intergenic
1026873120 7:73865244-73865266 CACTGAGCAAGGCCAGGCCCAGG - Exonic
1026947336 7:74325024-74325046 CACAAACCACTGCCAGGCCCCGG - Intronic
1027139919 7:75649724-75649746 CTTCAGCCAAGACCAGGCCGGGG - Intronic
1027247900 7:76379780-76379802 CTCCCACCAAGGCTAGGCTGGGG - Intergenic
1027674978 7:81145923-81145945 CTCCACCCACTGACAGGCCCTGG + Intergenic
1029062829 7:97816320-97816342 CTCCATCCCATGACAGGCCCTGG - Intergenic
1029661424 7:101964784-101964806 CTCCAATTAAGGCCAGCGCCAGG - Intronic
1031872885 7:127106604-127106626 CTCCTACCAAGCCCAAGCCATGG - Exonic
1031910594 7:127513002-127513024 CCCCACCCAATGACAGGCCCTGG - Intergenic
1032475775 7:132210719-132210741 TTACAACTAGGGCCAGGCCCTGG + Intronic
1032780897 7:135164678-135164700 CGCCAAGCCTGGCCAGGCCCAGG - Exonic
1033954181 7:146824040-146824062 CTCCAACCCCTGACAGGCCCTGG + Intronic
1034735837 7:153428859-153428881 CTCCAACCATGCTCATGCCCTGG + Intergenic
1034978109 7:155459488-155459510 TTCCAACTCAGGCCAGGCCGGGG + Intronic
1035266402 7:157692294-157692316 CACCTCCCCAGGCCAGGCCCAGG + Intronic
1035367274 7:158357465-158357487 CTCACCCCAAGGCCAGACCCCGG + Intronic
1035577242 8:715653-715675 CCCCAGCCAAGGCCAGGTCAGGG - Intronic
1036017186 8:4798166-4798188 CCCCACCCAATGACAGGCCCCGG + Intronic
1036830144 8:12014744-12014766 CTTCAACCCAGGGCCGGCCCCGG + Intronic
1038453130 8:27652561-27652583 CTCCAGCCAGGGCCAGGACGAGG - Intronic
1038856490 8:31338630-31338652 CCCCAACCAGGACCTGGCCCAGG - Intergenic
1039086625 8:33786703-33786725 CTCCAAACAGGCCCACGCCCAGG - Intergenic
1039521634 8:38176740-38176762 CGCCAGCCAATCCCAGGCCCGGG - Exonic
1039764778 8:40616723-40616745 CCCCAACCCACGGCAGGCCCCGG - Intronic
1040570547 8:48605570-48605592 CTCCAACCAAAGCCAGGAAAAGG + Intergenic
1040672264 8:49705812-49705834 CTCCACCCCACGACAGGCCCTGG + Intergenic
1041348831 8:56929014-56929036 CTCCAAGAGAGGCCAGGTCCGGG + Intergenic
1041665319 8:60438781-60438803 CTCCACCCCATGACAGGCCCTGG + Intergenic
1041718423 8:60952959-60952981 TTTCCACCAAGGCCAGGCCTCGG - Intergenic
1041928780 8:63265558-63265580 CTCCAACCAGGGCCAAGCTGGGG + Intergenic
1043497793 8:80822275-80822297 CCCCAACCCATGACAGGCCCCGG + Intronic
1043761737 8:84076943-84076965 CTCCACCCCATGACAGGCCCCGG + Intergenic
1045754561 8:105527562-105527584 CTCCAGCCTTGGCCAGGCGCTGG + Intronic
1046302859 8:112320644-112320666 CTCCACCCCACGACAGGCCCCGG + Intronic
1047421492 8:124711502-124711524 CTCCAGCCCAGCCCAGCCCCAGG + Intronic
1048183868 8:132220970-132220992 CTCCACCCCATGACAGGCCCCGG + Intronic
1048479792 8:134778541-134778563 TACCAACCATGGCCTGGCCCTGG + Intergenic
1049387989 8:142353885-142353907 CTCCACCCAGTGCCAGGCCTCGG - Intronic
1049391764 8:142375293-142375315 GTCCAGCACAGGCCAGGCCCTGG - Intronic
1049782739 8:144436240-144436262 CACCAGCCATGGCCAGGCCTCGG - Exonic
1050388889 9:5115894-5115916 CTCCACCCAACAACAGGCCCTGG - Intronic
1050668348 9:7967449-7967471 CTCCAACTGAGACCAGGCACTGG + Intergenic
1051300968 9:15650236-15650258 CTCCACCCCACGACAGGCCCCGG - Intronic
1052604530 9:30682062-30682084 CCCCAACCCATGACAGGCCCCGG - Intergenic
1053569491 9:39288938-39288960 CTTCCACCAAGGCCAGGACTAGG - Intergenic
1053835452 9:42129958-42129980 CTTCCACCAAGGCCAGGACTAGG - Intergenic
1054127655 9:61330071-61330093 CTTCCACCAAGGCCAGGACTAGG + Intergenic
1054595173 9:67058652-67058674 CTTCCACCAAGGCCAGGACTAGG + Intergenic
1056909368 9:90684286-90684308 CTGCACCCAGGGCCAGGACCTGG - Intergenic
1057035711 9:91810541-91810563 CTGCAAGCAGGGCCCGGCCCAGG + Intronic
1057179494 9:93022134-93022156 CTCCAGCTCAGGCCAGGCCCAGG + Intronic
1057188578 9:93072982-93073004 CTCCAGCCAGGACCATGCCCTGG - Intronic
1058085448 9:100743308-100743330 CTCCACCCCATGACAGGCCCTGG + Intergenic
1058096981 9:100872761-100872783 CTCCACCCCATGACAGGCCCTGG - Intergenic
1061546505 9:131307862-131307884 CACCAGCCAGGCCCAGGCCCTGG - Intronic
1062178695 9:135179140-135179162 CTCCCACAAAGGCCACGACCAGG + Intergenic
1062284916 9:135768577-135768599 CTCCACCCACGCTCAGGCCCTGG + Intronic
1062645753 9:137547348-137547370 CACCAACCAAGGCCAGGGCCAGG + Exonic
1203519127 Un_GL000213v1:30095-30117 CCCAAACCAAGGCAAGCCCCTGG - Intergenic
1185612603 X:1401700-1401722 CTCCACCCCAGCCCAGCCCCAGG + Intergenic
1185844803 X:3427879-3427901 CTCCAGCCAGGGAGAGGCCCTGG + Intergenic
1186355316 X:8783992-8784014 CTCCGACCAAGGCTCGGCCTCGG + Intergenic
1186379555 X:9043605-9043627 CTCCACCCCATGACAGGCCCTGG + Intronic
1186974155 X:14881999-14882021 CCCCACCCCATGCCAGGCCCTGG - Intronic
1188896909 X:35680183-35680205 CTCCAACCCCCGGCAGGCCCCGG + Intergenic
1188987485 X:36780485-36780507 ATCCATTCAAGGGCAGGCCCAGG - Intergenic
1189482767 X:41405888-41405910 CCCCCAACAAGGGCAGGCCCTGG - Intergenic
1189525399 X:41814578-41814600 CTCCACCCAACGACAGGCCCCGG - Intronic
1190316552 X:49155671-49155693 CTCCACCCCACGACAGGCCCCGG - Intergenic
1191011893 X:55769078-55769100 CCCCAACCCACGACAGGCCCTGG + Intergenic
1192921780 X:75714391-75714413 CTCCACCCATGAACAGGCCCTGG + Intergenic
1193488755 X:82120764-82120786 CTCCACCCCACGACAGGCCCCGG - Intergenic
1193654891 X:84187590-84187612 CTCCGCCCAAGGCCGAGCCCGGG + Intronic
1194974037 X:100375251-100375273 CTCCACCCCAAGACAGGCCCAGG + Intronic
1195060700 X:101191451-101191473 CTCCCTCCCCGGCCAGGCCCGGG - Intergenic
1195542317 X:106076522-106076544 CTCCAAGGAAGCCCAGGCTCTGG - Intergenic
1195729674 X:107953734-107953756 CCCCAACCCCTGCCAGGCCCCGG + Intergenic
1195763576 X:108273088-108273110 CTCCACCCCACGACAGGCCCCGG + Intronic
1196186453 X:112749571-112749593 CTCCACCCCACGACAGGCCCTGG + Intergenic
1196796662 X:119507383-119507405 CTCCACTCAAGGCCATCCCCGGG - Intergenic
1196978978 X:121190795-121190817 CTCAAACCAAGACCAGGGACTGG - Intergenic
1197908332 X:131451181-131451203 CTCCACCCCATGACAGGCCCTGG - Intergenic
1198128550 X:133671809-133671831 CCCCATCCCACGCCAGGCCCCGG + Intronic
1198744159 X:139872516-139872538 CTCCACCCCACGACAGGCCCCGG + Intronic
1199477986 X:148267343-148267365 CTCCAACCCCTGACAGGCCCTGG + Intergenic