ID: 1183191641

View in Genome Browser
Species Human (GRCh38)
Location 22:36325404-36325426
Sequence TCCCGGTGGCTCCACCTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183191641_1183191647 6 Left 1183191641 22:36325404-36325426 CCAGTAAGGTGGAGCCACCGGGA 0: 1
1: 0
2: 2
3: 9
4: 80
Right 1183191647 22:36325433-36325455 AAGCTCCCCTGATGGCTTCAAGG 0: 1
1: 0
2: 0
3: 16
4: 189
1183191641_1183191645 -2 Left 1183191641 22:36325404-36325426 CCAGTAAGGTGGAGCCACCGGGA 0: 1
1: 0
2: 2
3: 9
4: 80
Right 1183191645 22:36325425-36325447 GAGCGGCCAAGCTCCCCTGATGG 0: 1
1: 0
2: 0
3: 3
4: 79
1183191641_1183191651 17 Left 1183191641 22:36325404-36325426 CCAGTAAGGTGGAGCCACCGGGA 0: 1
1: 0
2: 2
3: 9
4: 80
Right 1183191651 22:36325444-36325466 ATGGCTTCAAGGAACACCACTGG 0: 1
1: 0
2: 0
3: 5
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183191641 Original CRISPR TCCCGGTGGCTCCACCTTAC TGG (reversed) Intronic
900150660 1:1177978-1178000 TCCCAGTGGCCCCACCCGACTGG + Intronic
900385037 1:2406642-2406664 TCAAGGTGGGTGCACCTTACAGG + Intronic
911574376 1:99557489-99557511 TCCAGGGGGCTCTACCTCACAGG - Intergenic
1062985230 10:1762121-1762143 TCCCGTTGTCTCTATCTTACAGG + Intergenic
1065645924 10:27833971-27833993 TCCACATGGCGCCACCTTACAGG + Intronic
1070916880 10:80160789-80160811 TCCCTGCAGCTCCACCCTACAGG + Intronic
1072718386 10:97766392-97766414 TCCCTGTGGCCCCACCTTCTTGG + Intergenic
1076541508 10:131218086-131218108 TCCCGGTGGCCCCAGCTGCCTGG + Intronic
1081764485 11:45600076-45600098 TCTCTGTGGCTCCATCTAACTGG - Intergenic
1081993467 11:47349759-47349781 CCCCGGTGGACCCACCTTGCTGG + Exonic
1083470462 11:62880817-62880839 TCCCCGAGGTTCCACCTTAAGGG + Intronic
1084213487 11:67634525-67634547 TCCCTGTGGCTGCACCTGGCTGG + Intronic
1086230926 11:84568854-84568876 ACCTCGTGGCTCCACCTGACTGG + Intronic
1096783549 12:54004550-54004572 TCCCCGTAGCATCACCTTACAGG + Intronic
1097172710 12:57126645-57126667 TCCCGGTGTCTCTTCCTTGCTGG - Intronic
1098285334 12:68901351-68901373 TCCAGGTGGCCTCACCTTTCAGG - Intronic
1105404020 13:20118935-20118957 TCCCGGTGTCGCCTCCTTTCAGG + Intergenic
1107338913 13:39385382-39385404 TCCCACTGGCTCCTCCTTAGAGG - Intronic
1114830939 14:26140707-26140729 TCCCTGGGTCTCCAGCTTACTGG + Intergenic
1115532625 14:34341358-34341380 TTCCAGTTGCTCCACCTTTCTGG - Intronic
1119558595 14:75572122-75572144 TGCAGGTGGCTCCACCTGTCTGG + Intergenic
1121600038 14:95196453-95196475 ACTCTCTGGCTCCACCTTACGGG + Intronic
1129742627 15:77997136-77997158 TCCTGGTGTCTCCACCTGCCTGG - Exonic
1131261150 15:90888574-90888596 TCCCACTGGCTTCACCTTCCAGG - Intronic
1132771616 16:1566841-1566863 TCCCAGTGGCCCCACCTCCCTGG + Intronic
1132846700 16:2004033-2004055 ACCCGGTGGCTCCACCCTGCGGG + Intronic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1139751017 16:69108874-69108896 TACTGGTGGCTGCACTTTACTGG + Intronic
1139836366 16:69841873-69841895 TCCTGGTGGCTGCAGCTTGCCGG + Intronic
1140918583 16:79516109-79516131 TCCCAGTGGCTCTGCCTTGCTGG - Intergenic
1141021385 16:80500076-80500098 TCTGGGTGGGTCCACCTAACAGG + Intergenic
1142288973 16:89184068-89184090 TCCCCGTGGCTGGAGCTTACAGG - Intronic
1144957942 17:19028955-19028977 TCCCAGTGGCTCCACCTCTGGGG + Intronic
1144977216 17:19145565-19145587 TCCCAGTGGCTCCACCTCTGGGG - Intronic
1147671980 17:42181410-42181432 TCCTTGTGGCTCCACCTCGCGGG + Intergenic
1149047878 17:52268818-52268840 TACCAGTGGCTCCACCTTGGAGG + Intergenic
1153431880 18:5026474-5026496 ACCCCGTGTTTCCACCTTACAGG + Intergenic
1153916413 18:9749589-9749611 TCCCAGGGGCTCTACCTTACTGG + Intronic
1160985927 19:1838716-1838738 TCCCGCTGGCTCCTCCCTGCCGG - Intronic
1167278526 19:48553085-48553107 TCCCCGTGGCTCCATCTTTTAGG + Intronic
927521909 2:23704021-23704043 TGCCGTGGGCTCCACCCTACTGG - Intronic
933641691 2:84769149-84769171 TCCCCATGGCTCTCCCTTACAGG - Intronic
935219656 2:101001806-101001828 GCCCTGTGGCTCCACCGCACAGG + Intronic
936036849 2:109120178-109120200 GCCAGGTGACTCCACCCTACAGG - Intergenic
937727857 2:125187988-125188010 TTCCTGAGGCTCCACCTTAGTGG + Intergenic
938289530 2:130141967-130141989 TCCCGGTGGCTTCAGCTTGCAGG + Intronic
938467000 2:131530971-131530993 TCCCGGTGGCTTCAGCTTGCAGG - Intronic
946183627 2:217964452-217964474 TCCTGGTTCCACCACCTTACCGG + Intronic
948364522 2:237446105-237446127 TCCCGCTAGCCCCACCTTGCCGG + Intergenic
1170737055 20:19021683-19021705 TCCCCATGGCTCCAGCTTCCAGG + Intergenic
1171148384 20:22805400-22805422 TGCCTGTGGCTTCAGCTTACTGG - Intergenic
1173625148 20:44466983-44467005 TGCGGGTGGCAGCACCTTACTGG + Intergenic
1174500526 20:50980957-50980979 TGCCGGTGCCTCCACCTGCCTGG - Intergenic
1176033289 20:63024090-63024112 CCACGGTGGCACCACCTTGCGGG + Intergenic
1177644419 21:23883976-23883998 TTCCAGTTGCTCCACCTTTCCGG - Intergenic
1181108772 22:20589622-20589644 TCCTGGTGGTTTCAGCTTACAGG + Intergenic
1181918279 22:26298438-26298460 ACTCAGTGCCTCCACCTTACAGG - Intronic
1183191641 22:36325404-36325426 TCCCGGTGGCTCCACCTTACTGG - Intronic
1183602710 22:38849392-38849414 TACCACTGGCTCCACCTTACAGG - Intergenic
1184470386 22:44692471-44692493 TCCCGGGGGCTCCTCCTCCCAGG + Intronic
1184748990 22:46473431-46473453 TGCCTGTGGCTCCATCTCACTGG - Intronic
1185248303 22:49785242-49785264 ACCAGGTGGCCCCACCTGACCGG - Intronic
953243447 3:41169605-41169627 TCCCTGTGTCTCCTGCTTACTGG + Intergenic
955046427 3:55364801-55364823 ACCCAGTGGGTCCACCTCACAGG - Intergenic
964755880 3:160090362-160090384 TCACTGTGCCTCCACCTCACGGG + Intergenic
968044467 3:195616322-195616344 TCCCGTTAGCTCCACCTTACAGG + Intergenic
968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG + Intronic
975195401 4:71518357-71518379 TCCCTGTGGCTCCACCCTCCAGG - Intronic
980987924 4:139714018-139714040 TCCCGTGGTCTCCACCTTCCAGG - Intronic
983403385 4:167294372-167294394 TCCCTGTGTCTCCACCCTGCAGG + Intergenic
988049941 5:26015092-26015114 CACCGGTGGCTCCACCTCCCAGG + Intergenic
1002182572 5:177438574-177438596 TCGCGGCTGCTCCACCTCACAGG - Intronic
1003939693 6:11011893-11011915 ACCCGCTGGCCCCACCTTCCTGG - Intronic
1004485242 6:16060273-16060295 TTCCTGTGGCTCCACCTCAGTGG - Intergenic
1006147030 6:31965860-31965882 ACACGATGGCTCCACCTTCCGGG + Exonic
1006316272 6:33293666-33293688 ACCAGGTGGCTCCACCTCACAGG + Exonic
1007728598 6:43932161-43932183 TCCCGGAGACTCCACCCTAAGGG + Intergenic
1016686144 6:146884392-146884414 TCCTCATGGCTCCACCTTCCTGG + Intergenic
1018182023 6:161232560-161232582 GCCGAGTGGCTCCACCTTCCAGG - Intronic
1018787825 6:167121893-167121915 CCCCAGTGGCTCCCCCTTACTGG - Intergenic
1018804811 6:167250221-167250243 TCCCTGCGGCTCCTCCTTCCAGG + Intergenic
1035453606 7:158995553-158995575 TGCCGGTGGCGCCACATTTCAGG + Intergenic
1038443251 8:27586166-27586188 TCCCTGTGGACCCACTTTACTGG + Intergenic
1045067597 8:98464497-98464519 TCCCTGTGGCTCAGCCTTATGGG - Intronic
1047309161 8:123677394-123677416 TCCACGTGGCTCCCCCATACAGG - Intergenic
1049113768 8:140667802-140667824 TTCAGCTGGCTCCTCCTTACAGG + Intronic
1051140986 9:13978761-13978783 TGCTGGTGGCTGCACATTACGGG - Intergenic
1051746048 9:20295814-20295836 TCCCAGGGTCTCCAGCTTACAGG + Intergenic
1054775376 9:69120501-69120523 GCCCAGTGGGTCCACCTTGCCGG - Intergenic
1058908573 9:109499972-109499994 TCCAGGGGGCTCCTCCTTCCGGG - Intergenic
1060847190 9:126846940-126846962 TCCTGGTGGCTCCTCCCTCCAGG - Intergenic
1187389387 X:18875856-18875878 TCCCTGTCTCTCCACCTTGCAGG + Intergenic