ID: 1183191641 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:36325404-36325426 |
Sequence | TCCCGGTGGCTCCACCTTAC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1183191641_1183191651 | 17 | Left | 1183191641 | 22:36325404-36325426 | CCAGTAAGGTGGAGCCACCGGGA | No data | ||
Right | 1183191651 | 22:36325444-36325466 | ATGGCTTCAAGGAACACCACTGG | No data | ||||
1183191641_1183191647 | 6 | Left | 1183191641 | 22:36325404-36325426 | CCAGTAAGGTGGAGCCACCGGGA | No data | ||
Right | 1183191647 | 22:36325433-36325455 | AAGCTCCCCTGATGGCTTCAAGG | No data | ||||
1183191641_1183191645 | -2 | Left | 1183191641 | 22:36325404-36325426 | CCAGTAAGGTGGAGCCACCGGGA | No data | ||
Right | 1183191645 | 22:36325425-36325447 | GAGCGGCCAAGCTCCCCTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1183191641 | Original CRISPR | TCCCGGTGGCTCCACCTTAC TGG (reversed) | Intronic | ||