ID: 1183191641

View in Genome Browser
Species Human (GRCh38)
Location 22:36325404-36325426
Sequence TCCCGGTGGCTCCACCTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183191641_1183191651 17 Left 1183191641 22:36325404-36325426 CCAGTAAGGTGGAGCCACCGGGA No data
Right 1183191651 22:36325444-36325466 ATGGCTTCAAGGAACACCACTGG No data
1183191641_1183191647 6 Left 1183191641 22:36325404-36325426 CCAGTAAGGTGGAGCCACCGGGA No data
Right 1183191647 22:36325433-36325455 AAGCTCCCCTGATGGCTTCAAGG No data
1183191641_1183191645 -2 Left 1183191641 22:36325404-36325426 CCAGTAAGGTGGAGCCACCGGGA No data
Right 1183191645 22:36325425-36325447 GAGCGGCCAAGCTCCCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183191641 Original CRISPR TCCCGGTGGCTCCACCTTAC TGG (reversed) Intronic