ID: 1183191642

View in Genome Browser
Species Human (GRCh38)
Location 22:36325408-36325430
Sequence TAAGGTGGAGCCACCGGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183191631_1183191642 15 Left 1183191631 22:36325370-36325392 CCCCTCCTTACTTACGAAGGCCG No data
Right 1183191642 22:36325408-36325430 TAAGGTGGAGCCACCGGGAGCGG No data
1183191633_1183191642 13 Left 1183191633 22:36325372-36325394 CCTCCTTACTTACGAAGGCCGCA No data
Right 1183191642 22:36325408-36325430 TAAGGTGGAGCCACCGGGAGCGG No data
1183191632_1183191642 14 Left 1183191632 22:36325371-36325393 CCCTCCTTACTTACGAAGGCCGC No data
Right 1183191642 22:36325408-36325430 TAAGGTGGAGCCACCGGGAGCGG No data
1183191636_1183191642 -5 Left 1183191636 22:36325390-36325412 CCGCACACGGCACGCCAGTAAGG No data
Right 1183191642 22:36325408-36325430 TAAGGTGGAGCCACCGGGAGCGG No data
1183191634_1183191642 10 Left 1183191634 22:36325375-36325397 CCTTACTTACGAAGGCCGCACAC No data
Right 1183191642 22:36325408-36325430 TAAGGTGGAGCCACCGGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183191642 Original CRISPR TAAGGTGGAGCCACCGGGAG CGG Intronic