ID: 1183191779

View in Genome Browser
Species Human (GRCh38)
Location 22:36326252-36326274
Sequence CCTCCCCTTCTGAGGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183191779_1183191786 29 Left 1183191779 22:36326252-36326274 CCTTCCAGCCTCAGAAGGGGAGG No data
Right 1183191786 22:36326304-36326326 AGGGCTGCCATGCAAACTCCAGG No data
1183191779_1183191783 9 Left 1183191779 22:36326252-36326274 CCTTCCAGCCTCAGAAGGGGAGG No data
Right 1183191783 22:36326284-36326306 AACGAGCTGCAAAAGCCAAGAGG No data
1183191779_1183191784 10 Left 1183191779 22:36326252-36326274 CCTTCCAGCCTCAGAAGGGGAGG No data
Right 1183191784 22:36326285-36326307 ACGAGCTGCAAAAGCCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183191779 Original CRISPR CCTCCCCTTCTGAGGCTGGA AGG (reversed) Intronic
No off target data available for this crispr