ID: 1183192835

View in Genome Browser
Species Human (GRCh38)
Location 22:36332637-36332659
Sequence TTATCCAGAGTGTCTGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183192835_1183192840 16 Left 1183192835 22:36332637-36332659 CCCCCTCCAGACACTCTGGATAA 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1183192840 22:36332676-36332698 AAAAAAAAAAAAAAACCTCAAGG 0: 23
1: 220
2: 2113
3: 13184
4: 78897

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183192835 Original CRISPR TTATCCAGAGTGTCTGGAGG GGG (reversed) Intronic
900357194 1:2270674-2270696 CTCTCCAGAGGGGCTGGAGGTGG + Intronic
901987224 1:13085615-13085637 TGACCCAGAGAGGCTGGAGGTGG + Intergenic
901994588 1:13141152-13141174 TGACCCAGAGAGGCTGGAGGTGG - Intergenic
903295464 1:22340618-22340640 TTCTCCCCAGTGTCTGGATGAGG + Intergenic
903460306 1:23516303-23516325 TTGTCCAGAGGGACAGGAGGTGG - Intronic
903727543 1:25461949-25461971 TTATCCAGCTTGGTTGGAGGAGG + Intronic
903798828 1:25951325-25951347 TGATTCAGAAGGTCTGGAGGGGG - Intergenic
904610194 1:31721544-31721566 TTAGCCACAGTTCCTGGAGGTGG - Intergenic
905717470 1:40164567-40164589 TTATCCACACTGTCTGGCAGTGG - Intronic
906538154 1:46563535-46563557 TTTTGCAGGGTGTGTGGAGGCGG - Intronic
909454797 1:75838167-75838189 TTTTCCAAAGGCTCTGGAGGGGG + Intronic
909669168 1:78168821-78168843 TTCTCCATGGTGTCTGGATGGGG + Intergenic
910081546 1:83347972-83347994 TTATCCACTGTGTATGGAGACGG + Intergenic
913126985 1:115800262-115800284 TTATCCAGAGGGTGATGAGGAGG + Intergenic
916233660 1:162563692-162563714 TTTTCCCAAGTGTCTGAAGGTGG + Intronic
918342348 1:183578293-183578315 TTTTCCAAAGTGTAGGGAGGAGG - Intronic
919285129 1:195548649-195548671 TTTTCCCTAGTTTCTGGAGGTGG - Intergenic
919716879 1:200787498-200787520 TTATCAAAATTGTCTGGATGAGG + Intronic
923523591 1:234755657-234755679 GTAGTCAGAGTGTCTGGAGGAGG + Intergenic
924016842 1:239735936-239735958 TTTTCCATAGTGTCTGCAGAAGG - Intronic
1062935444 10:1382787-1382809 TTACCCAGAGGGTGGGGAGGCGG - Intronic
1063323999 10:5079181-5079203 TTGTCCAGTGTGTCTGAGGGTGG + Intronic
1064432527 10:15283477-15283499 TTATTCACAGTATCTGGTGGAGG + Intronic
1064857576 10:19787315-19787337 TTTTCCATGGTGTCTGGAAGAGG + Intronic
1072037380 10:91575732-91575754 TGATCCAGTCTGTCTGGAGTGGG - Intergenic
1072327207 10:94310439-94310461 TAAACCAGAGTCTCTGCAGGTGG + Intronic
1074108756 10:110408152-110408174 CTACCCAGAGGGGCTGGAGGAGG + Intergenic
1074838112 10:117319495-117319517 TTGCCCAGAGTTTCTAGAGGAGG - Intronic
1075436295 10:122445559-122445581 TTTTCCTGATTGTCTAGAGGAGG + Intergenic
1075461956 10:122622409-122622431 TTATCCAGAATGTTTAGTGGTGG + Intronic
1077082014 11:728465-728487 TTAACCACAGTGTCTGGTCGGGG + Intergenic
1078350157 11:10586381-10586403 TTAACCAGAGGGTGTGGGGGAGG - Intronic
1080186272 11:29490924-29490946 TTGGGCAGAGTGTCTGAAGGTGG + Intergenic
1080262224 11:30361767-30361789 TAAGCCAGTGTGCCTGGAGGAGG - Intergenic
1085154045 11:74277035-74277057 CTATGCAGAGTATCTGCAGGTGG - Exonic
1085318751 11:75561953-75561975 TTATGCAGAGAGCCTGGGGGTGG + Intergenic
1085349552 11:75789821-75789843 TTATCCACAGTGTCTGGGCTGGG + Intronic
1089360490 11:117882914-117882936 TTCTCCAGACTGAATGGAGGTGG - Intergenic
1089952058 11:122536907-122536929 TAATCCTCAGTGTTTGGAGGTGG + Intergenic
1093200586 12:16181704-16181726 TTTTCCAAAGTGTCTAGAGAAGG + Intergenic
1094408615 12:30146472-30146494 TTATCCAGATTGGCTGGTGTTGG - Intergenic
1095413512 12:41949442-41949464 TTATCCCAAGTGTCAGGAGAGGG + Intergenic
1096805569 12:54139044-54139066 TTATTCAGAGTCTCTGGGAGAGG - Intergenic
1100658209 12:96669555-96669577 TGATCCACACTGGCTGGAGGTGG + Intronic
1102216589 12:111165896-111165918 CTATCCACAGTGTTTGGTGGTGG + Intronic
1103843799 12:123887390-123887412 CTACCCACAGTGTCTGGAGGTGG - Intronic
1104155173 12:126124298-126124320 TTCTCAAGAGTTTCTGGATGAGG + Intergenic
1104857257 12:131908032-131908054 GTGTCCTGAGGGTCTGGAGGTGG + Intronic
1106303671 13:28492461-28492483 TTTCCCAGAATGTCTGGAAGAGG + Intronic
1108568520 13:51726228-51726250 TTATCAAGTGTGTGTGGAGGGGG - Intronic
1110558946 13:76889212-76889234 TTATACAGAGTGCCTGGGGAAGG + Intergenic
1113899726 13:113789568-113789590 TTAGCCAGAGGAGCTGGAGGAGG + Intronic
1114777672 14:25503483-25503505 ATATCCAGAGTGTGTGGAGCTGG - Intergenic
1116656361 14:47658191-47658213 AAATCCTGATTGTCTGGAGGTGG + Intronic
1116784057 14:49268407-49268429 TTATTTAGGGTATCTGGAGGAGG + Intergenic
1116805299 14:49488703-49488725 TTTTACAGAGATTCTGGAGGAGG + Intergenic
1118815959 14:69314050-69314072 TAAACCAGAATCTCTGGAGGTGG - Intronic
1120415800 14:84216772-84216794 ACATCCAGAGTGCCTGGGGGTGG + Intergenic
1121545352 14:94759056-94759078 TGACTCAGAGGGTCTGGAGGTGG - Intergenic
1124243093 15:28047253-28047275 TGAATCAGAGTCTCTGGAGGAGG - Intronic
1126864502 15:52922429-52922451 GTGTCAGGAGTGTCTGGAGGAGG + Intergenic
1127407562 15:58667649-58667671 GTATCCAGAGTATCATGAGGTGG + Intronic
1127465118 15:59236598-59236620 ATCTCCAGAGTGTCTGGAGGAGG - Exonic
1127570191 15:60234321-60234343 TTAGGCATAGTGTCTGGCGGGGG - Intergenic
1128606309 15:69039000-69039022 ATGTGCAGAGTGACTGGAGGAGG - Intronic
1129150018 15:73682715-73682737 TGGTCCAGAGTTCCTGGAGGTGG + Intergenic
1131786226 15:95913998-95914020 TTATCCACTGTGTAGGGAGGGGG + Intergenic
1132249567 15:100325108-100325130 CCCTCCAGAGTGGCTGGAGGTGG + Intronic
1132416137 15:101620185-101620207 TTACCCAAAGTGGCTGGACGTGG - Intergenic
1132461252 16:56166-56188 ATTTCCAGTGTGTCTGGAAGTGG + Intronic
1133315485 16:4881093-4881115 TTTTCCAGAGTTCGTGGAGGTGG + Exonic
1134001496 16:10786535-10786557 GTTTCCAGAGTGTCTGAAAGAGG - Intronic
1138516471 16:57538012-57538034 TTGCCCAGAGTTTTTGGAGGTGG + Intergenic
1139306212 16:65988386-65988408 TTATCTAAAGTCACTGGAGGAGG - Intergenic
1141152692 16:81575189-81575211 TTATCCCCAGTTTATGGAGGAGG + Intronic
1142328497 16:89434207-89434229 GAATCCATAGTGTCTTGAGGAGG - Intronic
1142744165 17:1947497-1947519 TAATTCAGCGTGTCGGGAGGAGG - Intronic
1146503923 17:33388248-33388270 TTCCCCAGAGCCTCTGGAGGGGG + Intronic
1147309252 17:39584719-39584741 TTTCCCAGAGTGTCTGGAAGAGG + Intergenic
1147349970 17:39834899-39834921 TTCTCCAGAGCCTGTGGAGGAGG - Intronic
1147553815 17:41463736-41463758 TGAACCAGAGTCTCTGGAGGTGG - Intronic
1148332575 17:46821115-46821137 TTCTCCAGGCTGCCTGGAGGAGG - Intronic
1149411952 17:56417723-56417745 TTATTCAGTGTGTCTGTGGGAGG + Intronic
1149546253 17:57505988-57506010 TTTTAAAGAGAGTCTGGAGGGGG - Intronic
1150630313 17:66875908-66875930 TCATCCAGTGGGGCTGGAGGGGG - Intronic
1152727133 17:81952942-81952964 CTAGGCAGACTGTCTGGAGGAGG - Exonic
1153825558 18:8871038-8871060 TAATGCTGAGTTTCTGGAGGTGG - Intergenic
1157591647 18:48839783-48839805 TTCTCCAGGGTGTCTGAAGGGGG - Intronic
1158324246 18:56297150-56297172 TGATTCAGAGGGTCTGAAGGTGG - Intergenic
1161286272 19:3469940-3469962 TGATCCACAGTGCCTGGGGGTGG + Intergenic
1162038978 19:7958002-7958024 TTTTCCTGAGGATCTGGAGGGGG + Intergenic
1162571678 19:11478118-11478140 TTGTCCAGGGTGACAGGAGGAGG + Intronic
1162585181 19:11553967-11553989 TTTTCCAGAGGGTGGGGAGGGGG - Intronic
1166009959 19:39934815-39934837 CTGTCCAGCGGGTCTGGAGGTGG + Intergenic
1166563338 19:43747836-43747858 TTCTCCAGAGGGGCTGGAGCAGG + Exonic
1167279673 19:48559626-48559648 CCACCCAGAGGGTCTGGAGGAGG + Intronic
1168163862 19:54533315-54533337 GAATCCAGCGTGTCTGGGGGTGG + Intronic
1168636001 19:57997538-57997560 AAATCCAGAGTGTGGGGAGGGGG + Intronic
926153933 2:10440162-10440184 TTGTCCAGAGCCTCTGGTGGTGG - Exonic
928135923 2:28687429-28687451 TTAACCTGAGTGACTGGAGAGGG - Intergenic
928538036 2:32258784-32258806 CTTTTCAGAGTGTGTGGAGGAGG - Intronic
929126143 2:38524194-38524216 TTATTCAGACTGCTTGGAGGAGG + Intergenic
931689370 2:64822304-64822326 TGATCCCCAGTGTTTGGAGGTGG + Intergenic
932369448 2:71175283-71175305 TCACTCAGAGTCTCTGGAGGGGG - Intergenic
934511518 2:94947930-94947952 TTTTGCATTGTGTCTGGAGGTGG + Intergenic
935268092 2:101411567-101411589 TTAGCCAGAGTGTTGGGAAGGGG + Intronic
938623619 2:133084145-133084167 TTATCCAGGGTGGCTGGATAAGG + Intronic
938648857 2:133359903-133359925 TTATACAGACTTTTTGGAGGTGG + Intronic
939095352 2:137827563-137827585 TTAATCAGAGTGTCTGGGAGTGG - Intergenic
940373361 2:152925975-152925997 TAATCCCGTGTGTCTGGAGCTGG + Intergenic
943812473 2:192205680-192205702 TAATCCAGAGTGTGTGGAGCTGG - Intergenic
943912042 2:193581368-193581390 TGATCTAGAGGCTCTGGAGGAGG - Intergenic
946398157 2:219453812-219453834 TAGTCCAGAGTGGCTGGATGGGG + Intronic
948808858 2:240464949-240464971 TTCTCCAGCGTGCCTGAAGGTGG - Exonic
1170768546 20:19312496-19312518 TTGTGCAGAGTGGCTGGAGGAGG - Intronic
1174056411 20:47801437-47801459 GGAGACAGAGTGTCTGGAGGAGG + Intergenic
1174583317 20:51588693-51588715 TTATCCAGGGTGGCTGCTGGAGG - Intergenic
1175794558 20:61763531-61763553 GTGTCCAGAGGGTCTGGAGTGGG + Intronic
1177588167 21:23126232-23126254 TTATCCATAGTGACTGGGAGAGG + Intergenic
1179128768 21:38615687-38615709 TTATTTAGAGTGTCTGGCAGTGG + Intronic
1179188086 21:39100266-39100288 TAATCCAGAATGTATGGAGATGG - Intergenic
1180211942 21:46300013-46300035 GCATCCAGAGTGTCTGGTGAGGG - Intergenic
1181643024 22:24214752-24214774 TTGTCCAGATGCTCTGGAGGTGG + Intergenic
1182081131 22:27529530-27529552 TTAGCCTGAGTGCCAGGAGGAGG + Intergenic
1183192835 22:36332637-36332659 TTATCCAGAGTGTCTGGAGGGGG - Intronic
1183950567 22:41350343-41350365 TGATTTACAGTGTCTGGAGGAGG + Intronic
1184316185 22:43691790-43691812 TTATCGTGATTATCTGGAGGAGG - Intronic
1184557713 22:45241932-45241954 GTATCCAATGTGTCGGGAGGAGG - Intergenic
951235859 3:20235894-20235916 CTATACAGAGTTTCTGGAAGTGG - Intergenic
952316461 3:32237133-32237155 TGATTCAGAGGGTCTGGGGGTGG + Intergenic
959704752 3:109329636-109329658 TAACCCAGAGTGTCTGGAAAGGG + Intronic
960327290 3:116313349-116313371 CAATACAGAGTGACTGGAGGCGG + Intronic
961009655 3:123427161-123427183 TTGTCCAGGGAGGCTGGAGGAGG - Intronic
962224551 3:133594769-133594791 TAATTCAGAATGTCTGGATGTGG - Intergenic
962748162 3:138413038-138413060 TTTTCCAGAGTGTCTGCACTGGG + Intergenic
963627725 3:147694121-147694143 TTATCAAGAGTGTTGGGGGGTGG - Intergenic
963983717 3:151568321-151568343 GTTTGCACAGTGTCTGGAGGAGG - Intergenic
964058790 3:152495296-152495318 TTATCCAGGGTGTTTGGTTGTGG - Intergenic
966680572 3:182637860-182637882 TGATCCAGGGTAGCTGGAGGAGG - Intergenic
969341585 4:6545156-6545178 TTTTCCAAAATGTCTGGAGGAGG - Intronic
972391427 4:38617323-38617345 TGATCCCCAGTGTTTGGAGGTGG + Intergenic
973576447 4:52294530-52294552 TGAACCAGACTATCTGGAGGTGG - Intergenic
973995944 4:56458774-56458796 TCAGGCAGAGTGTCTTGAGGTGG - Intronic
974654122 4:64797758-64797780 TTGAACAGAATGTCTGGAGGTGG - Intergenic
975329135 4:73094175-73094197 ATATCCAGAGTGATTGGAAGAGG - Exonic
976750617 4:88448439-88448461 TTATCCACAGGGTCTGGAAGAGG - Intergenic
977712419 4:100142864-100142886 TAATTCAGAGCATCTGGAGGTGG - Intergenic
977920306 4:102636015-102636037 TAATCAAGAGTGTCAGGAGACGG + Intronic
979745358 4:124206038-124206060 TCAGCCAGAGGGTCAGGAGGTGG + Intergenic
983722492 4:170873560-170873582 TTATCCACAGTGTATAGATGAGG - Intergenic
983743691 4:171167740-171167762 TTATCCAGTATTTCTGGAGGAGG - Intergenic
984455721 4:179965630-179965652 TTATTCAGGGTGCCTGGAGCAGG - Intergenic
986139650 5:5017750-5017772 TGAACCAGATTGTCTGGATGAGG + Intergenic
989092845 5:37752161-37752183 TTACCCAGAGTTTCAGGTGGAGG + Intronic
990015036 5:51050266-51050288 TTATCCATAGTGTGTGCAAGAGG - Intergenic
991271013 5:64781296-64781318 TTATTCAAAGTTTCTTGAGGAGG + Intronic
995828368 5:116327141-116327163 CTTTACAGAGTGTATGGAGGGGG + Intronic
996468812 5:123835438-123835460 TACTCCAGAGTGACTGAAGGAGG + Intergenic
1001839904 5:174866375-174866397 TTACCCTGAGTCTCTGGAGAAGG - Intergenic
1002051305 5:176573160-176573182 TCAGCCAGTGTGGCTGGAGGGGG + Intronic
1004441812 6:15662061-15662083 TTGACCAGAGTGCCTGGAGACGG - Intronic
1006432118 6:34003430-34003452 TTCTCCAGAGTCCCTTGAGGGGG + Intergenic
1018453727 6:163933129-163933151 TTGTCCAGATTGTCTGGTGATGG - Intergenic
1018735638 6:166685444-166685466 TTGTCCCGAGTGTCTGAGGGAGG - Intronic
1019591478 7:1837701-1837723 TTTTCCAGAGTTTCTGTAAGTGG - Intronic
1019872758 7:3780749-3780771 TTATCCAAAATGCCAGGAGGTGG - Intronic
1020790267 7:12618559-12618581 ATATCCAGAGTGGGTGGAGCTGG + Intronic
1020920039 7:14252488-14252510 CTATCCAGAGATTCTGGATGAGG + Intronic
1021087925 7:16445586-16445608 TGATTCAGTGTGTCTGGAGAGGG + Intergenic
1025236586 7:57238724-57238746 GGAGACAGAGTGTCTGGAGGAGG - Intergenic
1027299034 7:76810212-76810234 TTATCCACTGTGTATGGAGACGG + Intergenic
1028906956 7:96165201-96165223 TTATACAGAATGTTTGAAGGTGG + Intronic
1029015487 7:97311620-97311642 CTATCCAGAGTGGCTAGAGAAGG + Intergenic
1029696259 7:102215275-102215297 CTGTCCAGAGTGCCTGGAGCTGG + Intronic
1030405815 7:109111568-109111590 TTTTTCAGTGTGTCTAGAGGAGG + Intergenic
1031725712 7:125235557-125235579 TTGTCCAGAATGCCTAGAGGTGG - Intergenic
1032568276 7:132971307-132971329 TTATCCAGAGGCTTTGGAAGAGG - Intronic
1033658520 7:143388758-143388780 TTCTCCAGGGTGTCCTGAGGAGG - Exonic
1033711258 7:143948760-143948782 TTAACAAGAATGTTTGGAGGAGG - Intergenic
1037341549 8:17850977-17850999 TTACCCAGACTGTCTAGATGTGG - Intergenic
1041112107 8:54492991-54493013 TTATTCAGGTTGTTTGGAGGAGG + Intergenic
1042722539 8:71841782-71841804 TGATGCAGAGAGTCTGGAGTCGG + Exonic
1043356596 8:79420300-79420322 TTCTCCAGAGTTTTTGGAGTAGG - Intergenic
1045324748 8:101109830-101109852 TTAACCAGAGAGTGTGCAGGGGG + Intergenic
1045567046 8:103329984-103330006 TTCCCCAGAGAGTCTGGAGATGG - Exonic
1048343493 8:133558346-133558368 TTATCCAGATTTTATGGATGAGG + Intronic
1048486209 8:134850010-134850032 TGATTCAGTGGGTCTGGAGGGGG + Intergenic
1049504659 8:142989609-142989631 TTCAGCAGAGTGTCTGGAAGTGG - Intergenic
1050150706 9:2616982-2617004 TGATCCAGAAACTCTGGAGGTGG + Intergenic
1052283984 9:26763628-26763650 TAATCCCCAGTGTTTGGAGGTGG + Intergenic
1052572810 9:30250238-30250260 TTTTCAAGAGTTTCTGTAGGAGG - Intergenic
1053037430 9:34837173-34837195 GTTTTCAGAGTATCTGGAGGAGG + Intergenic
1056121668 9:83494241-83494263 TTCTCCACAGTGTGTGGAGGTGG + Intronic
1056367459 9:85919946-85919968 TAAATCAGAGTCTCTGGAGGTGG + Intergenic
1056423160 9:86449420-86449442 TTACTCAGTGTGTCTGTAGGAGG - Intergenic
1056780045 9:89542498-89542520 GTTTCCAGCGTGTCTGGAGATGG + Intergenic
1060441269 9:123641857-123641879 TGAACCAGAATGTCTGGAGATGG + Intronic
1060976904 9:127770337-127770359 TGTTCCTGAGTGTCTAGAGGAGG - Intronic
1061521308 9:131119907-131119929 TTAACCACACTGCCTGGAGGAGG - Intronic
1062064130 9:134517293-134517315 TTATACAAAGCGTCTGGAGTAGG - Intergenic
1062624699 9:137437462-137437484 TAACCCAGAGCCTCTGGAGGGGG + Intronic
1187032060 X:15498213-15498235 TTAGCCAGAGCAACTGGAGGGGG + Intronic
1189095431 X:38133561-38133583 TTATCCAAATTTTCTGGGGGAGG + Intronic
1191885533 X:65884105-65884127 TGATTCAGAGTCTCTGTAGGTGG + Intergenic
1197946626 X:131846168-131846190 TTCTCCAGAGTGACTAGAAGTGG - Intergenic
1198322314 X:135530580-135530602 TAATCCACAGCCTCTGGAGGAGG + Intronic
1198651278 X:138866211-138866233 TAAACCAGAATCTCTGGAGGTGG - Intronic
1198817189 X:140604229-140604251 TAAAGCAGAATGTCTGGAGGTGG + Intergenic
1200456891 Y:3404982-3405004 TTATACTGAGAGTCTGGAAGAGG + Intergenic