ID: 1183192942

View in Genome Browser
Species Human (GRCh38)
Location 22:36333340-36333362
Sequence TAGGATTCACTCCTGGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183192935_1183192942 27 Left 1183192935 22:36333290-36333312 CCTCGGAGGAGCGGTCGGTAGAA 0: 1
1: 0
2: 0
3: 3
4: 20
Right 1183192942 22:36333340-36333362 TAGGATTCACTCCTGGAGCACGG 0: 1
1: 0
2: 1
3: 17
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183192942 Original CRISPR TAGGATTCACTCCTGGAGCA CGG Intronic
904012904 1:27399824-27399846 TCAGATTCCCTCCTGGAGCCTGG + Intergenic
904496199 1:30888236-30888258 TGGGATTCAGGACTGGAGCAGGG + Intronic
911523945 1:98961893-98961915 TAGGATTCCTTAGTGGAGCAGGG - Intronic
912878550 1:113387022-113387044 TAGGATTCAGTCATGGTGAAAGG - Intergenic
913204008 1:116518782-116518804 TAGGGTTCACTTCAGGAGCCAGG - Intronic
915842896 1:159230688-159230710 TAGGCTTCACACCAGGTGCAGGG + Intergenic
917807368 1:178625823-178625845 TAGGATTCAGTTTTGGAGCTGGG - Intergenic
919092553 1:192992559-192992581 TTGGATTGCCTCCTGGAGAAAGG - Intergenic
919932588 1:202230966-202230988 TGGGACTCAATCCAGGAGCAAGG - Intronic
1063389583 10:5640541-5640563 TAGGCTTCTCTCCTGGATCCTGG - Exonic
1066992724 10:42531660-42531682 TAGGCTTCACCTCTGGGGCAGGG - Intergenic
1069071875 10:63998024-63998046 TAGGAATGAGTCCTGGTGCATGG - Intergenic
1071565507 10:86669563-86669585 GAGGAAGCACTCCAGGAGCAGGG + Intronic
1073035253 10:100560330-100560352 TTGGAATCAGTCCTGGAGCCAGG - Intergenic
1075209762 10:120481125-120481147 TGGCATACATTCCTGGAGCATGG + Intronic
1076491241 10:130862978-130863000 TAGGATCCCCTCCTGGGGCCTGG - Intergenic
1080221803 11:29914548-29914570 CAGGATTCACTCCTGTATAAAGG - Intergenic
1087625516 11:100591512-100591534 TAGCATTCATTACTTGAGCAAGG - Intergenic
1088847458 11:113680372-113680394 TTGGATTCTGTCCTGGAGCTTGG - Intergenic
1090740313 11:129654107-129654129 TAGGAATGAGTCCTGGTGCATGG - Intergenic
1090913393 11:131141416-131141438 TAGGATTTACCCCTGGAAAAAGG + Intergenic
1091103170 11:132894717-132894739 TAGGTTTCTTTCCTGGAGCTTGG + Intronic
1091103810 11:132899820-132899842 TAGGTTTCTTTCCTGGAGCTCGG + Intronic
1092755894 12:11763001-11763023 TAGGGTTCCTTCCTGAAGCAAGG - Intronic
1095351995 12:41224132-41224154 TAGGATTTTGTCCTGGAGCTGGG + Intronic
1095548276 12:43398538-43398560 TAAGATTGAATCCTGGAGAAGGG - Intronic
1097834568 12:64260149-64260171 TGGGATTTACTCCTGGATAATGG + Intergenic
1107029193 13:35833515-35833537 AAGAAGTTACTCCTGGAGCATGG + Intronic
1110321271 13:74162478-74162500 TGGGATTTACTCCTGGAGGAAGG - Intergenic
1116805336 14:49489004-49489026 CAGGACTGACACCTGGAGCATGG + Intergenic
1119426008 14:74535166-74535188 TAGGAATCACTTCTGCAGCCTGG + Intronic
1120037340 14:79712861-79712883 TAGGATTTAATACAGGAGCAGGG - Intronic
1120515868 14:85469381-85469403 TACGATTCATTCCTGCAGGAAGG - Intergenic
1121654107 14:95582457-95582479 AAGGCTTCCCTCCTGGAGCAAGG - Intergenic
1123893606 15:24806163-24806185 TAAGATTCAGAACTGGAGCATGG - Intergenic
1128221494 15:65971860-65971882 TAGGAACCATGCCTGGAGCAAGG + Intronic
1128657045 15:69470025-69470047 TAAGATCCTTTCCTGGAGCAAGG - Intergenic
1135356594 16:21774085-21774107 GAGGATTCACACCTGGGGCAAGG - Intergenic
1135455094 16:22590228-22590250 GAGGATTCACACCTGGGGCAAGG - Intergenic
1136091643 16:27925013-27925035 CAGGATTCACTCCTGGACTGGGG + Intronic
1136914036 16:34164223-34164245 AATGATGCATTCCTGGAGCAAGG + Intergenic
1137707332 16:50544717-50544739 TAAGTTTCACTCCTGGAGCCAGG - Intergenic
1141627373 16:85268439-85268461 TAGGACCCACACCTGGGGCAGGG - Intergenic
1142876711 17:2855500-2855522 TAGGATTCTCTCCTGGTTAATGG + Intronic
1145064704 17:19754290-19754312 TAGGAATTAATCCTGGGGCAAGG - Intergenic
1145213167 17:21030789-21030811 TAGGATTCAATCCAAGATCATGG - Intronic
1146700639 17:34956607-34956629 CAGGATCCACTCCTTGAGCTGGG - Intronic
1149651662 17:58279790-58279812 GAGGAGTCACTAGTGGAGCAGGG + Intronic
1150642802 17:66961017-66961039 CAGGTTTCACACCTGGAGGATGG - Intergenic
1152795216 17:82303159-82303181 CAGAATTCACCCCCGGAGCAGGG - Intergenic
1155938531 18:31779508-31779530 GAGGATTATGTCCTGGAGCAAGG - Intergenic
1156831629 18:41498938-41498960 TGGAATACACTCCTGGAACATGG + Intergenic
1156891718 18:42198064-42198086 AAGGCTTTACTCCTTGAGCATGG - Intergenic
1157075252 18:44458990-44459012 GATGAATCACTCCTTGAGCATGG + Intergenic
1161360680 19:3847859-3847881 CAGGCTCCACTCCTGGAGCCGGG + Intronic
1164503670 19:28840512-28840534 CAGGGTTTACTCCTGGAGGAAGG + Intergenic
1166253661 19:41587464-41587486 AAGAATTCAGTCCTTGAGCAAGG + Intronic
927928125 2:27027001-27027023 TGGGATTCAGTGCTGGGGCAGGG - Exonic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929260381 2:39860693-39860715 TAGGATTCCCTCCTATTGCAGGG + Intergenic
931851140 2:66251751-66251773 CAGGATTCATTCCTGCAGCCAGG - Intergenic
931943936 2:67284589-67284611 TAGAATTTTCTCCTGGAACAAGG + Intergenic
932664954 2:73689833-73689855 GAGGATTCTCTCCTAGATCAGGG - Intergenic
934653506 2:96105360-96105382 CAAGTTCCACTCCTGGAGCATGG + Intergenic
935727602 2:106037479-106037501 TGGGATTGGATCCTGGAGCAGGG - Intergenic
937313999 2:120919645-120919667 TGGGATTCACACCTGCAGCATGG + Intronic
940832965 2:158488823-158488845 TAGAATTCACTCCTGAGTCAGGG + Intronic
942873239 2:180761837-180761859 TAGGATTCATGCTGGGAGCAAGG - Intergenic
1169531330 20:6488381-6488403 TGGGATTCATTCTTGGAGCATGG + Intergenic
1170678525 20:18504421-18504443 TGGTATTCACTCCCGGAGCCAGG - Intergenic
1170979220 20:21195554-21195576 CAGGATGCAAACCTGGAGCAAGG - Intronic
1171810036 20:29740378-29740400 AATGATGCATTCCTGGAGCAAGG - Intergenic
1171908943 20:30922796-30922818 AATGATGCATTCCTGGAGCAAGG + Intergenic
1173537324 20:43825505-43825527 TGGAATTCACTCCTGTAGCCAGG - Intergenic
1175520408 20:59599164-59599186 GAGCCTTCACTCCTGGAGCAGGG + Intronic
1176661738 21:9642619-9642641 AATGATGCATTCCTGGAGCAAGG - Intergenic
1182794347 22:32979874-32979896 TAGGATTCAAACCTGGAGTATGG + Intronic
1183192942 22:36333340-36333362 TAGGATTCACTCCTGGAGCACGG + Intronic
1184522531 22:45003579-45003601 TGGGATTCATTCCAAGAGCAAGG + Intronic
950444199 3:13026658-13026680 AAGGATGGACTCCTGGAGAAGGG - Intronic
954082491 3:48220817-48220839 CAGGACTCACTCCTGGAACCTGG + Intergenic
955549180 3:60065284-60065306 CAGGATTCATCCCAGGAGCATGG - Intronic
957413352 3:79868790-79868812 AAGGAGTCAATCCTGCAGCATGG - Intergenic
960517919 3:118622804-118622826 TAGGAACCACTCCTGTAGAAAGG - Intergenic
962450989 3:135516835-135516857 TAGGATACACTCTCAGAGCAAGG + Intergenic
962628216 3:137248627-137248649 TAGGAAACTCTCCTGTAGCAAGG + Intergenic
965407455 3:168287781-168287803 TAAGATTCACTTCTGCAGGACGG - Intergenic
965546656 3:169923187-169923209 TAGGATTCACGCCTGGGTCAGGG + Intronic
966467731 3:180250421-180250443 TAAGAGTCACTACTTGAGCAGGG + Intergenic
969216962 4:5730689-5730711 CAGGATCCACGCCTGGAGGAAGG + Intronic
969303626 4:6312138-6312160 TAGGATTCACTGCTGGGCCACGG + Intergenic
969461624 4:7332132-7332154 AAGGATGCTCTCCTGTAGCAAGG - Intronic
974666332 4:64967471-64967493 CAGGATTTACTGCTGGAGGAAGG + Intergenic
974794182 4:66727614-66727636 TAGGATTCACTCCTAGAGAAGGG - Intergenic
975525149 4:75340731-75340753 AACTGTTCACTCCTGGAGCAGGG + Intergenic
977492924 4:97736760-97736782 TAGGCTCCACTTCTGGGGCAGGG + Intronic
978176678 4:105740285-105740307 TAGGACTCACTACTGGAGTGAGG + Intronic
979945866 4:126830506-126830528 TAATATTCACTCATGGATCAAGG - Intergenic
982836927 4:160130847-160130869 TGGGTTTCTCTCCTGTAGCATGG - Intergenic
985236734 4:187883471-187883493 TAGGATTAACACCTGTAGGAGGG - Intergenic
985413661 4:189713929-189713951 AATGATGCATTCCTGGAGCAAGG + Intergenic
990088359 5:52007609-52007631 TAGGATTGATACCTGGAACAGGG - Intergenic
994359611 5:98835240-98835262 TAGGATTTACCCCTGGAGCTGGG - Intergenic
996432753 5:123400121-123400143 TAGGATTAACTCCTAGAAGAAGG - Intronic
998019449 5:138757103-138757125 TAGGATTCATTGCTTGAGCTTGG + Intronic
998298219 5:140992492-140992514 AAGGATTCAATCCTGGGGCATGG + Intronic
998853320 5:146371516-146371538 TAGGCTGCATTCCTAGAGCAGGG - Intergenic
999120342 5:149204930-149204952 TAGGATTCATTTCTAGAGTATGG + Intronic
1009576897 6:65476139-65476161 AAGGTTTCACTTCAGGAGCAGGG - Intronic
1009973004 6:70644764-70644786 TAGGGCACACCCCTGGAGCAGGG + Intergenic
1012942805 6:105433857-105433879 CAGGATTCACTCATGGATCAAGG - Intergenic
1015166715 6:130207271-130207293 TAGGAATACCTCCAGGAGCAGGG + Intronic
1017590675 6:155975269-155975291 TGGGATTCCCACCTGGAGAAGGG + Intergenic
1020488982 7:8755854-8755876 TAGGATTTGCTCCATGAGCAAGG + Intergenic
1022020662 7:26397587-26397609 TAGGATTTACTTCTGGGCCAAGG + Intergenic
1024469308 7:49750611-49750633 AGGGATTCCCTCCTAGAGCAGGG - Intergenic
1029184342 7:98727834-98727856 TAAAATTCACTCCTGGAGGCTGG + Intergenic
1029269314 7:99367327-99367349 TAGGATTCCCTCTTGGAGTGAGG - Intronic
1032718099 7:134528087-134528109 TAAGATTCAGCCCTGGAGCCAGG + Intronic
1033051007 7:138004121-138004143 TGGTATTCTCTCCTGGTGCAAGG - Intronic
1035016968 7:155775025-155775047 TAGGACTCACTCCACGATCAGGG - Exonic
1036468080 8:9021610-9021632 TAGGGTTAACTCCAGGAGGAAGG - Intronic
1037565293 8:20112812-20112834 TAGTATACGCTCCTGGAGAAAGG - Intergenic
1038086395 8:24202050-24202072 AAAGATTCCCTCCTGGATCAAGG - Intergenic
1045413481 8:101943552-101943574 TCCCAGTCACTCCTGGAGCAGGG + Intronic
1047732852 8:127740358-127740380 TAGAAATCACTCCTTTAGCAAGG - Intronic
1048974739 8:139664840-139664862 CTGGCTTCATTCCTGGAGCACGG + Intronic
1050500846 9:6295897-6295919 TAGGATCCACCTCTGGAGCAGGG + Intergenic
1052695425 9:31871449-31871471 TACAATTCCCTCCTGGAGAAGGG - Intergenic
1055625881 9:78176942-78176964 TAGGATTCACTCCCTGTGGAAGG - Intergenic
1056345016 9:85683961-85683983 TGGGATTCACTTCTGTATCAGGG - Intronic
1058648202 9:107150363-107150385 TGGCTTTCACTCCTGGATCATGG + Intergenic
1061466999 9:130788589-130788611 TAGGATCCAGTCCTGGATCATGG + Intronic
1203360327 Un_KI270442v1:216118-216140 AATGATGCATTCCTGGAGCAAGG - Intergenic
1203639299 Un_KI270750v1:144462-144484 AATGATGCATTCCTGGAGCAAGG - Intergenic
1186946918 X:14578919-14578941 TAGGATCCACTGCTGTAGCATGG - Intronic
1187312140 X:18155424-18155446 TACAATTCCCTCCTGGAGCTGGG + Intergenic
1187485519 X:19699542-19699564 TGAGATTCACTCTTGGGGCACGG - Intronic
1188243151 X:27812441-27812463 TAGGATTCACTCTTGTGTCATGG - Intronic
1192207274 X:69104941-69104963 TAGGAACCAGTCCTGGAGCCCGG - Intergenic
1192438956 X:71160724-71160746 TAGGATTCAATTCTGGAACCTGG - Intronic
1193380693 X:80813027-80813049 AAGGATTCTCCCCTAGAGCATGG - Intergenic
1197254028 X:124243765-124243787 TTGCTTTCACTCTTGGAGCAAGG + Intronic
1198759099 X:140012280-140012302 TAGGAATGAGTCCTGGTGCATGG + Intergenic
1198842663 X:140875659-140875681 TAGGCTTCACTCTTGGAGTCAGG - Intergenic
1201078103 Y:10201424-10201446 AATGATGCATTCCTGGAGCAAGG + Intergenic