ID: 1183199145

View in Genome Browser
Species Human (GRCh38)
Location 22:36373811-36373833
Sequence TCTCCTCAGTGGACATAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183199137_1183199145 29 Left 1183199137 22:36373759-36373781 CCAAGACTCAATAAAACTCGTGG 0: 1
1: 0
2: 1
3: 1
4: 66
Right 1183199145 22:36373811-36373833 TCTCCTCAGTGGACATAAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183199145 Original CRISPR TCTCCTCAGTGGACATAAGA GGG Intronic
900338880 1:2178428-2178450 CGTCCTCAGTGGACATAGGGTGG + Intronic
902274999 1:15333129-15333151 TCTGCTGAGTGGACAAAAGATGG - Intronic
902287068 1:15413657-15413679 TCTCCCCATTTGACAGAAGAGGG + Intronic
903087850 1:20879698-20879720 TCTCCTCAGTAGTGAAAAGAAGG - Intronic
903785626 1:25859349-25859371 TCTCCTCAGCGGCCATGAGGCGG - Exonic
904202767 1:28832140-28832162 TTTCCACAGTGGAAATCAGAGGG - Intronic
904579608 1:31532028-31532050 TCTATACAGTGGACATCAGAAGG - Intergenic
907726592 1:57025905-57025927 TCCCCTCAGTGGCCAGAATATGG - Intronic
909280811 1:73750561-73750583 TCAGCTCACTGGACATAAAAGGG + Intergenic
910226922 1:84945110-84945132 TCTCCTCATTGGCCACAGGAGGG + Intronic
911410893 1:97504924-97504946 TTTACTCAATGGACACAAGAGGG - Intronic
911543029 1:99182098-99182120 GCTCAACAGTGGACATAAAACGG + Intergenic
912350359 1:109006464-109006486 TCTTCTTTGTGGACATAAAAGGG - Intronic
912460020 1:109824228-109824250 CCTACTCAGTGCAAATAAGAGGG - Intergenic
915353606 1:155241976-155241998 TATCCTCAGTGGACACAAGGAGG + Intronic
915681449 1:157585606-157585628 TCTCCTCAATGGACAAAAGTGGG + Intronic
915894494 1:159801107-159801129 TCTCCTCTGTGGACAGAACATGG - Intronic
917043112 1:170828311-170828333 TCTAGACAGTGGACATGAGAAGG + Intergenic
918194814 1:182211407-182211429 TAGCCTTAGTGGACATGAGAGGG - Intergenic
919796742 1:201325508-201325530 TCTCCTCAGGGGCCATGAGGTGG - Intronic
920496649 1:206459704-206459726 TCAACTCAGTTGAGATAAGAAGG - Intronic
920692509 1:208157905-208157927 TCTCCTCTGTGGCCTGAAGATGG - Intronic
922761862 1:228138073-228138095 TTTCCTCAGTTGGCATAATAAGG + Intergenic
922768506 1:228168925-228168947 TCTCCTCAGCCGTCAGAAGAGGG + Intronic
1062942912 10:1438220-1438242 TCTCCTCAGTGGACGGAAGCAGG + Intronic
1062942960 10:1438449-1438471 TCTCCTCGGTGGACAGAAGCAGG + Intronic
1062943283 10:1439904-1439926 TCTCCTCAGTGGACGGAGGCAGG + Intronic
1064915005 10:20447248-20447270 TCTCCTATGTGGACAGCAGAAGG - Intergenic
1065404278 10:25346081-25346103 ACTCCTCAGTGGACTTAGCAAGG + Intronic
1065452759 10:25875804-25875826 TCTTCTCAGTGTACCCAAGAAGG - Intergenic
1066498778 10:35970265-35970287 TCTCCTCAGTGGACCAAGGCAGG - Intergenic
1069250127 10:66256934-66256956 TGTCCTCACTAGAAATAAGAGGG + Intronic
1070700695 10:78599714-78599736 TCTCTTCAGTGGTCACATGAAGG - Intergenic
1076157936 10:128217558-128217580 TCTTCTCAGTGTTTATAAGATGG - Intergenic
1079176870 11:18150291-18150313 TATTCTCATTTGACATAAGAAGG - Intronic
1080436533 11:32249947-32249969 TCTCCTCAGGGAACATCTGAGGG - Intergenic
1081445241 11:43124908-43124930 TCTCAGCAGTGGTCATAAGTAGG + Intergenic
1085457234 11:76671984-76672006 TCTCCACAGTGGACTGAACAGGG - Intergenic
1088510371 11:110567289-110567311 TCTCCTCACTGGTCACCAGATGG - Intergenic
1093267072 12:17016219-17016241 TGGCCTCAGTGGTCATCAGAGGG + Intergenic
1093465272 12:19442076-19442098 ACTCTTCAGTGGAAATAATAGGG - Intronic
1103019576 12:117523192-117523214 TCTCATAAGTGGACTTAAGAAGG + Intronic
1103983279 12:124750640-124750662 TCTCCTCACTTAATATAAGAGGG + Intergenic
1109104078 13:58226945-58226967 TAACTTCAGTGGACATCAGATGG - Intergenic
1110617491 13:77557510-77557532 TCTCCTCATTTTACAAAAGAGGG + Intronic
1112778078 13:102867096-102867118 TCTCCACAGTGAACAAAAGGTGG + Intronic
1112948797 13:104963765-104963787 TCACCTTAGTGGATATAAAATGG - Intergenic
1113636488 13:111922460-111922482 TGTCCTCAGTGCCCAGAAGAAGG + Intergenic
1116825772 14:49672055-49672077 TTTCAACAGTGGAGATAAGAGGG + Intronic
1119567814 14:75643725-75643747 TCTCCACAGTGGCCATACTATGG - Intronic
1122447283 14:101779356-101779378 TCTCCTCAGTGTTCTTAAGGGGG - Intronic
1131842953 15:96457616-96457638 TCTCATCAGTGATCCTAAGAAGG - Intergenic
1139495251 16:67312187-67312209 TGTCCTCAGTGGACTTCAGGGGG + Intronic
1140126867 16:72125046-72125068 TCTTCTCAGTGGCCAGCAGAGGG + Intronic
1141142841 16:81508302-81508324 TCTCCTTTGTGGACATAATTAGG + Intronic
1144790130 17:17853295-17853317 TCTGCTAAGTGGACAAAAGCTGG - Intronic
1152045083 17:77930199-77930221 ACTCCTCGGTGGACATCAGGAGG - Intergenic
1156107436 18:33681919-33681941 TTTTTTCAGTGGACATAACAGGG - Intronic
1157118403 18:44884279-44884301 TCACCTCATTTGGCATAAGAAGG + Intronic
1160895255 19:1399427-1399449 TCCCCCCAGTGCACATCAGAGGG + Intronic
1163627980 19:18401873-18401895 TGTCCTCAGTAGACAGCAGAGGG + Intergenic
1164419832 19:28079243-28079265 CCTCCTCAGGGGACAGATGAGGG + Intergenic
1164612512 19:29642363-29642385 TCTCATTAGTGGCCAAAAGATGG - Intergenic
1164917539 19:32063978-32064000 CCTTCCCAGTGGACATCAGAGGG - Intergenic
1166942426 19:46374948-46374970 TCTCTTCAGTGGACAAAACAGGG + Intronic
1167208980 19:48121392-48121414 GCTCCTCAGTGGACTGAGGAGGG + Intronic
1168141531 19:54391177-54391199 TCTCCACTGTGGCCACAAGAGGG - Intergenic
925677554 2:6380903-6380925 TCTCATCAGTGGAGACAAAAAGG - Intergenic
929646164 2:43630694-43630716 GCTACTCAGTGGACCAAAGAGGG - Intergenic
931104964 2:59045486-59045508 TCTCCTGAGTGAAACTAAGAGGG - Intergenic
931167033 2:59759208-59759230 TCCCAGCAGTGGACAAAAGAAGG + Intergenic
932505804 2:72230443-72230465 TATCCTCATTTGACACAAGAAGG - Intronic
940139474 2:150477536-150477558 TCTCCTTTGTGGCCATAAAATGG - Intronic
944893908 2:204144763-204144785 TCTCTTCAGGTGACCTAAGAAGG - Intergenic
945050136 2:205816044-205816066 ACTCCTCTGTGGGCATTAGAAGG - Intergenic
947787645 2:232838026-232838048 TCTCCTGAGTGGGCATTATAGGG + Intronic
1168889897 20:1288154-1288176 TCACCTCAGCGGACATCAGCAGG - Intronic
1169945687 20:10985609-10985631 TTTCCTCTGTGGACTTCAGAGGG + Intergenic
1170300607 20:14880681-14880703 TCTCCTCATTGGTCATTAGAGGG - Intronic
1170546799 20:17441348-17441370 TCTCCTCTGAGGACATCAAAGGG + Intronic
1173417005 20:42865782-42865804 TCTCCGCAGGGGAAAGAAGAAGG + Intronic
1176686527 21:9852780-9852802 TATCCTCACTGGACAGAAGAAGG - Intergenic
1179089372 21:38250309-38250331 TCTTCTCTGTGGATATTAGAGGG + Intronic
1179090985 21:38265641-38265663 TCTTCTAAATCGACATAAGACGG - Intronic
1181529320 22:23507742-23507764 TCTCCTCTGAGGACAGAGGAGGG + Intergenic
1183199145 22:36373811-36373833 TCTCCTCAGTGGACATAAGAGGG + Intronic
1185131513 22:49041881-49041903 TCTCCACAGAGGACAGAAAAGGG + Intergenic
949879699 3:8651739-8651761 TCTCTCCAGTTGACATTAGATGG - Intronic
951840824 3:27032215-27032237 TCTCCTGAGTGGAGAAAAGGTGG - Intergenic
952079097 3:29735902-29735924 TCTCCTGAATGGACCTAAGGTGG - Intronic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
953375379 3:42423823-42423845 TCTCCTCTGTGGTCCCAAGATGG - Intergenic
954296726 3:49678486-49678508 GCACCACAGTGGAGATAAGACGG + Intronic
955838206 3:63081725-63081747 TATCCTCAGAGGAAATAAAAAGG - Intergenic
956374476 3:68599743-68599765 TTTCCTCAGAGGACAAAAAAAGG - Intergenic
957548502 3:81672283-81672305 TCTCCTAAATGTACACAAGAAGG + Intronic
962924155 3:139976464-139976486 TCTCCTCAGTGCACGGATGAGGG + Intronic
971701969 4:29989508-29989530 TCTCTCCAGTGGGCATAAGTAGG + Intergenic
974777552 4:66505959-66505981 TCTTCTCAGAGGACAAAACAAGG - Intergenic
975514932 4:75236598-75236620 TCTTCTCAGTGGACAGAACTAGG - Intergenic
975819347 4:78253846-78253868 CCTCCTTAGTGGACAGAAAAAGG + Intronic
976591348 4:86852267-86852289 TCTCCCCAGTGGAGATGGGAAGG + Intergenic
978861623 4:113457002-113457024 TCTTCTCAATTGACAGAAGAAGG - Intronic
980342402 4:131567543-131567565 TCTGCTCAGTGGACAGAACTTGG + Intergenic
980349972 4:131671249-131671271 TATCCTCACTGGACAGAAGAAGG - Intergenic
983279946 4:165667639-165667661 TATCCTTAATGGACATAATATGG + Intergenic
984585806 4:181562974-181562996 ACTCCCCAGTGGCCCTAAGAAGG - Intergenic
984599035 4:181705089-181705111 TCTCCTCATTGGACATAGGGTGG + Intergenic
986514942 5:8551401-8551423 TCTCCTCAGTTGACAAAGAAGGG - Intergenic
986563935 5:9091713-9091735 GCTCCTCAGTGGACATAATGCGG + Intronic
986947176 5:13036919-13036941 TCTTCTCAGTTGACAGAACAGGG - Intergenic
990020781 5:51124773-51124795 TATCCTCAGTTGAAATAAGAGGG - Intergenic
992212734 5:74496640-74496662 TCTCCCCAGTGGAGAGAAAATGG - Intergenic
998992017 5:147827602-147827624 TTTCCTCAGTGACCATAAGTAGG - Intronic
1001724574 5:173886354-173886376 TGTCCCCAGTGGCCAGAAGAGGG - Intergenic
1001811255 5:174630003-174630025 TCTCCTGGGTGGACATTAGGGGG - Intergenic
1004300110 6:14449874-14449896 TCCCTTCAGTGCACACAAGATGG - Intergenic
1004355857 6:14929517-14929539 TCTAATCAGTGGGCATAAAAGGG + Intergenic
1010537980 6:77054525-77054547 TTTCCTCACTGCACAAAAGAAGG - Intergenic
1010637061 6:78273061-78273083 TCTTATCACTGGACATAAGAAGG - Intergenic
1011430548 6:87281825-87281847 TCTGCTCTGTGGACACCAGAAGG + Intergenic
1012421960 6:99075543-99075565 TCCCTTCAGTGGTCCTAAGAGGG + Intergenic
1013158594 6:107519678-107519700 TCTACCCAGGGGACAAAAGAAGG - Intronic
1027531223 7:79335657-79335679 CATCCTTAGTGGACAAAAGATGG + Intronic
1041466543 8:58163039-58163061 TCTCCTCAGGGGACATAGATGGG - Intronic
1041521743 8:58764362-58764384 TCTCCACAGTGGACATCTCAGGG + Intergenic
1044296045 8:90528529-90528551 TGTCTTCAGTGGAGACAAGATGG - Intergenic
1045922893 8:107553263-107553285 CCTGCTCAGTGGAAATGAGATGG + Intergenic
1047463440 8:125090732-125090754 CCTCTTCAGAGGACAAAAGAAGG + Intronic
1053021224 9:34695674-34695696 GTTCCTCAGTGGACACCAGATGG - Intergenic
1055910692 9:81347324-81347346 TCTACTCAATGAACCTAAGATGG - Intergenic
1059678872 9:116567030-116567052 TATCCTCAATGTACATATGAAGG + Intronic
1187228268 X:17395116-17395138 TCACCTCAGTGGCCATAAGGTGG - Intronic
1191780497 X:64858947-64858969 TTTCCTTAGTGGAGATAATAGGG - Intergenic
1194971534 X:100349241-100349263 TCTAATCAGTGCACATAAGAGGG + Intronic
1195260159 X:103123994-103124016 TCTCCTCAAAGGACAAAACATGG + Intergenic
1196883285 X:120219998-120220020 TCTACTCACTGGACTTAACAGGG - Intergenic
1197563529 X:128052477-128052499 TGTCCTCAGTGAGCATCAGAGGG + Intergenic
1197829978 X:130631127-130631149 CCCCCTGAGTGGACATGAGAGGG + Intronic
1199338296 X:146645015-146645037 TTTCCTCAGTGGAAACTAGAAGG - Intergenic
1199594776 X:149497953-149497975 TGTCCTCAGTGGAGTAAAGATGG - Intronic
1200312339 X:155090615-155090637 TATGCTCAGTCAACATAAGATGG - Intronic