ID: 1183201111

View in Genome Browser
Species Human (GRCh38)
Location 22:36386727-36386749
Sequence CACCCCCAGCACTAGCTTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 157}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183201111_1183201115 12 Left 1183201111 22:36386727-36386749 CCGGCAAGCTAGTGCTGGGGGTG 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1183201115 22:36386762-36386784 TTGAAACAGCGGGGCTTCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 365
1183201111_1183201112 1 Left 1183201111 22:36386727-36386749 CCGGCAAGCTAGTGCTGGGGGTG 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1183201112 22:36386751-36386773 TGAGTCTCAGTTTGAAACAGCGG 0: 1
1: 0
2: 2
3: 13
4: 186
1183201111_1183201113 2 Left 1183201111 22:36386727-36386749 CCGGCAAGCTAGTGCTGGGGGTG 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1183201113 22:36386752-36386774 GAGTCTCAGTTTGAAACAGCGGG 0: 1
1: 1
2: 0
3: 11
4: 115
1183201111_1183201116 21 Left 1183201111 22:36386727-36386749 CCGGCAAGCTAGTGCTGGGGGTG 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1183201116 22:36386771-36386793 CGGGGCTTCCCTGGAGAATGAGG 0: 1
1: 0
2: 0
3: 15
4: 198
1183201111_1183201117 22 Left 1183201111 22:36386727-36386749 CCGGCAAGCTAGTGCTGGGGGTG 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1183201117 22:36386772-36386794 GGGGCTTCCCTGGAGAATGAGGG 0: 1
1: 0
2: 0
3: 20
4: 263
1183201111_1183201114 3 Left 1183201111 22:36386727-36386749 CCGGCAAGCTAGTGCTGGGGGTG 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1183201114 22:36386753-36386775 AGTCTCAGTTTGAAACAGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183201111 Original CRISPR CACCCCCAGCACTAGCTTGC CGG (reversed) Intronic
900108389 1:995829-995851 CACCCCCATCCCTAACTTGCCGG + Intergenic
901458643 1:9378212-9378234 CAACCCCACCCCCAGCTTGCTGG + Intergenic
903153322 1:21428345-21428367 CACCACCAGCACGAACTTGCTGG - Intergenic
904661127 1:32086047-32086069 CACCCCCACCACTCCCTTTCTGG - Intronic
905626594 1:39493611-39493633 CACCACCAGCTCTGGGTTGCGGG - Intronic
905670298 1:39786845-39786867 CACCACCAGCTCTGGGTTGCGGG + Intronic
906253600 1:44330628-44330650 CACCCCCAGCAAAGGCTGGCAGG - Intronic
906460564 1:46032712-46032734 CACGCCCAGCACTAACCTTCAGG - Exonic
908517823 1:64911456-64911478 CACCCCCAACAATATCATGCCGG + Intronic
909997112 1:82294454-82294476 CACCACCAGCACTATCTTACTGG + Intergenic
911887970 1:103327500-103327522 CACCCCCAGCAGCAGCTACCTGG - Intergenic
913455650 1:119027928-119027950 CACACCCAGCATTTGCTAGCTGG + Intergenic
915511452 1:156388956-156388978 CTGCCCCATCACTAGCTTGCGGG + Intergenic
917305416 1:173619100-173619122 CACCACCAGCCCTGCCTTGCAGG + Intronic
919781256 1:201222651-201222673 CCCCTCCAGCCCTACCTTGCTGG + Intronic
922696478 1:227733493-227733515 CACCCACGGAACCAGCTTGCTGG - Exonic
1063172850 10:3525354-3525376 GACACCCAGCAGTAGATTGCTGG - Intergenic
1064036993 10:11922124-11922146 CACCCCCAGCAGTAGAAGGCAGG + Intronic
1069030918 10:63595293-63595315 CCCACTCAGCACTAGCTTCCTGG + Intronic
1071601265 10:86959726-86959748 GAGCCCCAGCACTAGGATGCAGG - Intronic
1076505498 10:130970414-130970436 CATCCCCACCACTCACTTGCTGG - Intergenic
1077176685 11:1194326-1194348 CACCCCGTGGACTGGCTTGCGGG - Intronic
1077407003 11:2387137-2387159 CACCCCCAGCCCTCCCTGGCTGG - Intronic
1080387882 11:31820242-31820264 AGCCCCCAGCACTAGATTTCTGG - Intronic
1081933679 11:46889943-46889965 CACCCCCAGCGCCAACCTGCAGG - Exonic
1083626379 11:64074049-64074071 CACCCCCATCCCCAGCTGGCCGG - Intronic
1084677731 11:70646097-70646119 GACCCCCAGAACTCGCATGCTGG + Intronic
1087293452 11:96343221-96343243 CACCCCCATCTGCAGCTTGCTGG - Intergenic
1089278650 11:117356810-117356832 TACCCTCAGCCCTATCTTGCAGG - Intronic
1089391421 11:118104581-118104603 CACCCCCAGTTCTAGGTTGGGGG + Intronic
1090212853 11:124935151-124935173 CTCCACCAGCACCAGCTTCCTGG + Intronic
1090251780 11:125256548-125256570 CAACCCCAGCACTGGCTTGGTGG - Intronic
1090549949 11:127808761-127808783 CACTCCCTGCCCTAGCTTGATGG + Intergenic
1091261185 11:134235530-134235552 CACCCCCAGCACACTCCTGCTGG + Intronic
1091335790 11:134764769-134764791 CACCCCCTCCATTAGCTTGGAGG - Intergenic
1091837379 12:3595297-3595319 CACCCCCATCTTTAGCTTTCTGG + Intergenic
1096800805 12:54109207-54109229 CAGCTCCACCACTAACTTGCTGG - Intergenic
1097196434 12:57244609-57244631 CACCCCCAGCACAAGCAGCCTGG - Exonic
1100743175 12:97617608-97617630 CAGCCTCAGCACTACCATGCTGG + Intergenic
1103608592 12:122106962-122106984 CACCAGCTGCACTAGCTTCCGGG + Intronic
1106197788 13:27509077-27509099 CTCCACCAGCAGGAGCTTGCAGG - Intergenic
1110728415 13:78852849-78852871 CACCCCCAGACCCAGCTTCCAGG + Intergenic
1113861379 13:113489979-113490001 CACACCCAGCAGCACCTTGCTGG + Intronic
1121446868 14:93984244-93984266 CACTCCCAGCACAGACTTGCTGG + Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122942831 14:104990094-104990116 CACCCCCACCGTCAGCTTGCTGG - Intronic
1123012496 14:105356166-105356188 CACCCCCAGGCCCAGCCTGCAGG + Intronic
1123709915 15:22980036-22980058 CACTCCCTGCACTGGCTTCCCGG - Intronic
1123789004 15:23700994-23701016 CACCCTCACATCTAGCTTGCTGG + Intergenic
1124251841 15:28111931-28111953 CTCCTCCAGCACCTGCTTGCAGG + Exonic
1125190456 15:36986624-36986646 CAATCCCAGCACTAGCTGGGTGG + Intronic
1128107544 15:65055687-65055709 CACCCACAGCTCTGGCTTGTGGG + Intronic
1128471255 15:67955555-67955577 AAAACCCAGCACTAACTTGCAGG + Intergenic
1128734364 15:70044387-70044409 CACCCCCACCAGTAGCCTCCAGG - Intergenic
1129348512 15:74939656-74939678 AAGCCCCAGCACTAGGTTGGTGG - Intergenic
1129458768 15:75689499-75689521 CACCTCCAGCACCAGCTGGTCGG + Exonic
1130154162 15:81335155-81335177 CACTCCCAGCTCCAACTTGCAGG - Intronic
1132456802 16:28644-28666 CACCCCCAGCACTGACTGTCTGG + Intergenic
1134112095 16:11522035-11522057 CAACACCAGCACCAGCCTGCAGG - Exonic
1134211982 16:12285245-12285267 CTCTCCCAGCTCTTGCTTGCCGG + Intronic
1134690176 16:16186038-16186060 CAGCCCCAGCACTGACTAGCTGG - Intronic
1135137725 16:19897242-19897264 CACCCCCACCATTACCATGCAGG - Intergenic
1136545726 16:30953640-30953662 CACCACCACCACAGGCTTGCCGG - Exonic
1138063497 16:53915949-53915971 CAACCGCAGCAGTAGTTTGCAGG + Intronic
1142117927 16:88369815-88369837 GACCCCCAGCCCCAGCTTCCGGG + Intergenic
1142372613 16:89691444-89691466 CATCCCCATCAGCAGCTTGCGGG + Exonic
1143265406 17:5633275-5633297 CACCCCCATCTCTGTCTTGCAGG + Intergenic
1146233758 17:31137696-31137718 CACACCTTCCACTAGCTTGCTGG + Intronic
1146908044 17:36630468-36630490 AATCCCCAGCACTTGCTTGTGGG + Intergenic
1152239230 17:79152907-79152929 CACCCCCAGCACAGGAGTGCTGG - Intronic
1157294987 18:46435822-46435844 CCCACCCAGCACTGCCTTGCTGG - Intronic
1157812999 18:50711000-50711022 CCCACCCAGCACGGGCTTGCTGG + Intronic
1159185549 18:64967683-64967705 CACCTTCATCACTAGGTTGCTGG + Intergenic
1160191122 18:76714623-76714645 AACCCCCACCACCAGCATGCAGG - Intergenic
1165151621 19:33763969-33763991 CACCCCCAGCCCTGGCTGGGTGG - Intronic
925969703 2:9097758-9097780 CACCCCCAAGACTTGCCTGCAGG + Intergenic
926652096 2:15357862-15357884 AACCCACACCACTATCTTGCTGG + Intronic
927111280 2:19865215-19865237 CACCCCCACCGCTAGCATGAGGG - Intergenic
927838214 2:26418341-26418363 CACCCCCAGCTCTGTCCTGCAGG - Intronic
928076997 2:28274036-28274058 CACCTCCAGGACTAGCTCACTGG + Intronic
931458836 2:62433089-62433111 CACCTCCATGACTAGCTTGCAGG + Intergenic
932465565 2:71921729-71921751 CAGCCCCACCACTTACTTGCTGG - Intergenic
933659160 2:84913250-84913272 CACCCCCAGTGTTAGCTTCCTGG - Intergenic
934974126 2:98788420-98788442 AGCCACCAGCACCAGCTTGCTGG + Intergenic
935076385 2:99748436-99748458 CACCTCCACCGCTAACTTGCTGG - Intronic
935211049 2:100939476-100939498 CAGCCCCATCACTAGCTTCCTGG - Intronic
938073058 2:128318498-128318520 CACCACCAGCACGAACTTGCTGG + Exonic
938429188 2:131217789-131217811 CACGCCCGGCAGCAGCTTGCTGG + Intronic
940795444 2:158072198-158072220 CACCACCACCACTGGCTTGCAGG - Intronic
941299416 2:163783117-163783139 CACCCCCTGCACTATCCTTCTGG + Intergenic
941462276 2:165785635-165785657 CATATCCACCACTAGCTTGCTGG - Intronic
946231724 2:218295598-218295620 CACCCCCCATCCTAGCTTGCTGG - Intronic
947344619 2:229178019-229178041 CAGCCCCAGCAGCAGCTTACAGG + Intronic
947943197 2:234076457-234076479 CACCCCCTTCACTAGGTTGTGGG + Intronic
948464881 2:238147641-238147663 CACCCCCACCACTTCCTGGCGGG + Intronic
1168814832 20:729100-729122 CACCCTCAGCCCACGCTTGCAGG - Intergenic
1169535459 20:6534155-6534177 TACCCCCAGCAGTGGCGTGCGGG + Intergenic
1171852582 20:30319001-30319023 CAGCTCCACCACTAACTTGCTGG - Intergenic
1173115869 20:40242191-40242213 CACCCCCAGCACCATCCTCCAGG + Intergenic
1175790670 20:61738130-61738152 CACCTCCAGCACTGGCTTTGGGG + Intronic
1175907920 20:62390860-62390882 CACCCCCAGCACCTGCTAGCAGG - Exonic
1176199961 20:63855676-63855698 CACCCCCAGCCCTTCCTTCCTGG - Intergenic
1180865295 22:19115258-19115280 CTCCCTCAGCACCGGCTTGCTGG + Intronic
1183201111 22:36386727-36386749 CACCCCCAGCACTAGCTTGCCGG - Intronic
1183300936 22:37058910-37058932 CAGCCCCAGGACAAGGTTGCAGG - Intronic
1184812179 22:46843568-46843590 CACTCCCAGCCCCAACTTGCTGG - Intronic
950665345 3:14491944-14491966 CACCCCAGGCACAAGCATGCAGG + Exonic
950668925 3:14513681-14513703 CACCTCCAGCACGACCTTGTGGG + Exonic
951997253 3:28744815-28744837 CACCTCCAGCAGTAGGTTACAGG + Intergenic
953326442 3:42015400-42015422 CATCCCCAGCGCTCGCTTGAGGG + Intronic
961112922 3:124300374-124300396 CACACCCATCCCTAGCTTGTAGG + Intronic
966212088 3:177463941-177463963 CAGCCCCAGCCCTAGCTCGTGGG + Intergenic
967075199 3:185995698-185995720 CAGCCCCAGCACTCCCTTCCAGG + Intergenic
969346087 4:6570974-6570996 CAGCCACAGCACCAGCTTGGAGG + Intergenic
970258757 4:14200234-14200256 AACCCCCAGCACTGTTTTGCTGG - Intergenic
981616984 4:146652675-146652697 CCCCCCCAGCACACTCTTGCAGG + Intergenic
981891053 4:149737804-149737826 CACACCTAGGAATAGCTTGCTGG - Intergenic
982802677 4:159723393-159723415 CACTCCCAGCACCTGCTTGGGGG - Intergenic
984140692 4:176001460-176001482 CACACCCAGCACTAGGACGCAGG - Intronic
984937027 4:184898430-184898452 CTCCACCACCACTAGCTTCCAGG - Intergenic
988565961 5:32320300-32320322 CAGGCCCAGCACTGGCCTGCAGG - Intergenic
991653856 5:68883392-68883414 CACCCCCAACTCTATCCTGCAGG - Intergenic
995369403 5:111401949-111401971 CAACACCAGCACTGGCTGGCTGG - Intronic
997952061 5:138250223-138250245 CACCCCCAGCCCTAGGTTAACGG + Intergenic
998059025 5:139104606-139104628 CATCACCAGCACTAGCCTGGAGG + Intronic
1001773546 5:174312545-174312567 CACCTCCTGCACCAGCTGGCGGG + Intergenic
1002313074 5:178326455-178326477 TACTCCCAGCCCCAGCTTGCTGG + Intronic
1002890545 6:1327805-1327827 CACTCTCAGCAGTAGCTGGCTGG - Intergenic
1004360751 6:14968622-14968644 AACCCACAGCATTAGCTAGCAGG - Intergenic
1008636118 6:53412636-53412658 CAGCCCCAGCACTAGCATCATGG + Intergenic
1010846954 6:80720696-80720718 CACCCCCACCACCACATTGCAGG + Intergenic
1012511603 6:100009132-100009154 CACCCCCAGCACATCCGTGCTGG + Intergenic
1013601518 6:111709441-111709463 CACCCCCAGCACATGCTGGCTGG - Intronic
1014548115 6:122755951-122755973 CGCCCGCAGCACTGGCTTGTTGG - Intergenic
1017795434 6:157840090-157840112 CACCCCAAGCACCAGCCTGAGGG - Intronic
1017795444 6:157840138-157840160 CACCCCAAGCACCAGCCTGAGGG - Intronic
1017795454 6:157840186-157840208 CACCCCAAGCACCAGCCTGAGGG - Intronic
1018218100 6:161550522-161550544 TACCTCCAGCACTACCTTCCCGG - Intronic
1019494732 7:1332443-1332465 CACCCCCACCCCTAGCTCCCTGG + Intergenic
1021389732 7:20077008-20077030 CATCCCCAGCACAAGTCTGCAGG + Intergenic
1022091815 7:27113118-27113140 CATCCCCAGCCCTTGCTTGGCGG - Intronic
1022996258 7:35758576-35758598 CACCCCCATCACTGACTTTCTGG - Intergenic
1029457677 7:100679264-100679286 CACCCCCAGCCCCAGCTGCCTGG - Intergenic
1029653878 7:101911781-101911803 CACCCCCAGCACTCGCTGGACGG - Intronic
1031150379 7:118047273-118047295 CACCCCCAGATCTAGGTTTCTGG + Intergenic
1034447260 7:151120040-151120062 CACCCCCAGCATCAGCCAGCGGG + Exonic
1034484707 7:151352021-151352043 CACCTCCAGGGCTAGCTAGCGGG + Intronic
1037573717 8:20180887-20180909 CACCACCAGCACCAGCTGCCGGG + Exonic
1039754651 8:40510755-40510777 CACACCCAGCCCTGGCTTGTAGG + Intergenic
1043024114 8:75045028-75045050 CACCCTCATGTCTAGCTTGCTGG - Intergenic
1046355703 8:113082059-113082081 CATCCCAAGGACTAGCCTGCTGG + Intronic
1049344302 8:142130311-142130333 CACCCCCACCCCCAGCTTCCAGG + Intergenic
1049559856 8:143304544-143304566 CACCTCCAACACTGTCTTGCTGG + Intronic
1052376986 9:27728716-27728738 CACGCACAGCACGAGCTTGAGGG + Intergenic
1053009755 9:34626252-34626274 CACCCCCAGCCCTGGCATACAGG - Intronic
1053287447 9:36859164-36859186 CAGCCCCAGGCCTGGCTTGCCGG - Intronic
1054154774 9:61632459-61632481 CAGCTCCACCACTAACTTGCTGG + Intergenic
1056699718 9:88892160-88892182 CGTCCCCAGCACTAGATTCCTGG - Intergenic
1056857015 9:90140337-90140359 GTCCCCCAGCCCTGGCTTGCAGG - Intergenic
1057261393 9:93586824-93586846 GTCCCCCAGCACTAGCTTCAGGG - Intronic
1057604565 9:96489732-96489754 AACCCCCAGTAAGAGCTTGCAGG + Intronic
1059798511 9:117726238-117726260 CACCACCACCACTAGCCTGGTGG - Intergenic
1060883272 9:127133506-127133528 CACCCACAGCCCTGGCTGGCAGG - Intronic
1061403594 9:130381867-130381889 CACCCCCAGCACTGCCATGAAGG + Intronic
1061958365 9:133975301-133975323 CACCCACAGCAGGAACTTGCTGG + Intronic
1062425638 9:136504957-136504979 CACCACCACCACCAGCGTGCCGG + Exonic
1186709516 X:12178766-12178788 CACCCCCATCTCCAGCCTGCAGG - Intronic
1190382537 X:49853763-49853785 TACCCTCAGCTCTAGCCTGCAGG + Intergenic
1192300272 X:69893921-69893943 CTCCCCCAGCACCAACTTTCTGG + Intronic
1200399560 X:156011079-156011101 CACCCCCAGCACTGACTGTCTGG - Intergenic