ID: 1183206969

View in Genome Browser
Species Human (GRCh38)
Location 22:36426344-36426366
Sequence GGCCAGCTGGGTCCCTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183206969_1183206973 -7 Left 1183206969 22:36426344-36426366 CCCACACAGGGACCCAGCTGGCC No data
Right 1183206973 22:36426360-36426382 GCTGGCCTCTCAGAGAGAAGAGG No data
1183206969_1183206977 13 Left 1183206969 22:36426344-36426366 CCCACACAGGGACCCAGCTGGCC No data
Right 1183206977 22:36426380-36426402 AGGCTCCCTGGAGGCCCAGCAGG No data
1183206969_1183206975 1 Left 1183206969 22:36426344-36426366 CCCACACAGGGACCCAGCTGGCC No data
Right 1183206975 22:36426368-36426390 CTCAGAGAGAAGAGGCTCCCTGG No data
1183206969_1183206976 4 Left 1183206969 22:36426344-36426366 CCCACACAGGGACCCAGCTGGCC No data
Right 1183206976 22:36426371-36426393 AGAGAGAAGAGGCTCCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183206969 Original CRISPR GGCCAGCTGGGTCCCTGTGT GGG (reversed) Intergenic
No off target data available for this crispr