ID: 1183206975

View in Genome Browser
Species Human (GRCh38)
Location 22:36426368-36426390
Sequence CTCAGAGAGAAGAGGCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183206958_1183206975 26 Left 1183206958 22:36426319-36426341 CCCTGCCCTGTCTCCCCCTGGAG No data
Right 1183206975 22:36426368-36426390 CTCAGAGAGAAGAGGCTCCCTGG No data
1183206965_1183206975 12 Left 1183206965 22:36426333-36426355 CCCCTGGAGCTCCCACACAGGGA No data
Right 1183206975 22:36426368-36426390 CTCAGAGAGAAGAGGCTCCCTGG No data
1183206963_1183206975 13 Left 1183206963 22:36426332-36426354 CCCCCTGGAGCTCCCACACAGGG No data
Right 1183206975 22:36426368-36426390 CTCAGAGAGAAGAGGCTCCCTGG No data
1183206960_1183206975 21 Left 1183206960 22:36426324-36426346 CCCTGTCTCCCCCTGGAGCTCCC No data
Right 1183206975 22:36426368-36426390 CTCAGAGAGAAGAGGCTCCCTGG No data
1183206959_1183206975 25 Left 1183206959 22:36426320-36426342 CCTGCCCTGTCTCCCCCTGGAGC No data
Right 1183206975 22:36426368-36426390 CTCAGAGAGAAGAGGCTCCCTGG No data
1183206970_1183206975 0 Left 1183206970 22:36426345-36426367 CCACACAGGGACCCAGCTGGCCT No data
Right 1183206975 22:36426368-36426390 CTCAGAGAGAAGAGGCTCCCTGG No data
1183206961_1183206975 20 Left 1183206961 22:36426325-36426347 CCTGTCTCCCCCTGGAGCTCCCA No data
Right 1183206975 22:36426368-36426390 CTCAGAGAGAAGAGGCTCCCTGG No data
1183206966_1183206975 11 Left 1183206966 22:36426334-36426356 CCCTGGAGCTCCCACACAGGGAC No data
Right 1183206975 22:36426368-36426390 CTCAGAGAGAAGAGGCTCCCTGG No data
1183206969_1183206975 1 Left 1183206969 22:36426344-36426366 CCCACACAGGGACCCAGCTGGCC No data
Right 1183206975 22:36426368-36426390 CTCAGAGAGAAGAGGCTCCCTGG No data
1183206967_1183206975 10 Left 1183206967 22:36426335-36426357 CCTGGAGCTCCCACACAGGGACC No data
Right 1183206975 22:36426368-36426390 CTCAGAGAGAAGAGGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183206975 Original CRISPR CTCAGAGAGAAGAGGCTCCC TGG Intergenic
No off target data available for this crispr