ID: 1183206977

View in Genome Browser
Species Human (GRCh38)
Location 22:36426380-36426402
Sequence AGGCTCCCTGGAGGCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183206971_1183206977 1 Left 1183206971 22:36426356-36426378 CCCAGCTGGCCTCTCAGAGAGAA No data
Right 1183206977 22:36426380-36426402 AGGCTCCCTGGAGGCCCAGCAGG No data
1183206970_1183206977 12 Left 1183206970 22:36426345-36426367 CCACACAGGGACCCAGCTGGCCT No data
Right 1183206977 22:36426380-36426402 AGGCTCCCTGGAGGCCCAGCAGG No data
1183206963_1183206977 25 Left 1183206963 22:36426332-36426354 CCCCCTGGAGCTCCCACACAGGG No data
Right 1183206977 22:36426380-36426402 AGGCTCCCTGGAGGCCCAGCAGG No data
1183206974_1183206977 -8 Left 1183206974 22:36426365-36426387 CCTCTCAGAGAGAAGAGGCTCCC No data
Right 1183206977 22:36426380-36426402 AGGCTCCCTGGAGGCCCAGCAGG No data
1183206967_1183206977 22 Left 1183206967 22:36426335-36426357 CCTGGAGCTCCCACACAGGGACC No data
Right 1183206977 22:36426380-36426402 AGGCTCCCTGGAGGCCCAGCAGG No data
1183206966_1183206977 23 Left 1183206966 22:36426334-36426356 CCCTGGAGCTCCCACACAGGGAC No data
Right 1183206977 22:36426380-36426402 AGGCTCCCTGGAGGCCCAGCAGG No data
1183206965_1183206977 24 Left 1183206965 22:36426333-36426355 CCCCTGGAGCTCCCACACAGGGA No data
Right 1183206977 22:36426380-36426402 AGGCTCCCTGGAGGCCCAGCAGG No data
1183206972_1183206977 0 Left 1183206972 22:36426357-36426379 CCAGCTGGCCTCTCAGAGAGAAG No data
Right 1183206977 22:36426380-36426402 AGGCTCCCTGGAGGCCCAGCAGG No data
1183206969_1183206977 13 Left 1183206969 22:36426344-36426366 CCCACACAGGGACCCAGCTGGCC No data
Right 1183206977 22:36426380-36426402 AGGCTCCCTGGAGGCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183206977 Original CRISPR AGGCTCCCTGGAGGCCCAGC AGG Intergenic
No off target data available for this crispr