ID: 1183211193

View in Genome Browser
Species Human (GRCh38)
Location 22:36452460-36452482
Sequence CAATTGATTCAGAGGGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183211193_1183211204 6 Left 1183211193 22:36452460-36452482 CCCTTTACCCTCTGAATCAATTG No data
Right 1183211204 22:36452489-36452511 ATCAGGGTCTGGCAGAGGGAGGG No data
1183211193_1183211202 2 Left 1183211193 22:36452460-36452482 CCCTTTACCCTCTGAATCAATTG No data
Right 1183211202 22:36452485-36452507 CTGTATCAGGGTCTGGCAGAGGG No data
1183211193_1183211201 1 Left 1183211193 22:36452460-36452482 CCCTTTACCCTCTGAATCAATTG No data
Right 1183211201 22:36452484-36452506 TCTGTATCAGGGTCTGGCAGAGG No data
1183211193_1183211205 7 Left 1183211193 22:36452460-36452482 CCCTTTACCCTCTGAATCAATTG No data
Right 1183211205 22:36452490-36452512 TCAGGGTCTGGCAGAGGGAGGGG No data
1183211193_1183211203 5 Left 1183211193 22:36452460-36452482 CCCTTTACCCTCTGAATCAATTG No data
Right 1183211203 22:36452488-36452510 TATCAGGGTCTGGCAGAGGGAGG No data
1183211193_1183211199 -10 Left 1183211193 22:36452460-36452482 CCCTTTACCCTCTGAATCAATTG No data
Right 1183211199 22:36452473-36452495 GAATCAATTGGTCTGTATCAGGG No data
1183211193_1183211206 14 Left 1183211193 22:36452460-36452482 CCCTTTACCCTCTGAATCAATTG No data
Right 1183211206 22:36452497-36452519 CTGGCAGAGGGAGGGGAAGTTGG No data
1183211193_1183211200 -5 Left 1183211193 22:36452460-36452482 CCCTTTACCCTCTGAATCAATTG No data
Right 1183211200 22:36452478-36452500 AATTGGTCTGTATCAGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183211193 Original CRISPR CAATTGATTCAGAGGGTAAA GGG (reversed) Intergenic
No off target data available for this crispr