ID: 1183211748

View in Genome Browser
Species Human (GRCh38)
Location 22:36455424-36455446
Sequence CAAGTTGAGCCCCTGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183211748_1183211752 -10 Left 1183211748 22:36455424-36455446 CCACCCTGCAGGGGCTCAACTTG No data
Right 1183211752 22:36455437-36455459 GCTCAACTTGCAGAAACCCTGGG No data
1183211748_1183211757 7 Left 1183211748 22:36455424-36455446 CCACCCTGCAGGGGCTCAACTTG No data
Right 1183211757 22:36455454-36455476 CCTGGGGCCTGCCTTCCCCAGGG No data
1183211748_1183211753 -9 Left 1183211748 22:36455424-36455446 CCACCCTGCAGGGGCTCAACTTG No data
Right 1183211753 22:36455438-36455460 CTCAACTTGCAGAAACCCTGGGG No data
1183211748_1183211763 23 Left 1183211748 22:36455424-36455446 CCACCCTGCAGGGGCTCAACTTG No data
Right 1183211763 22:36455470-36455492 CCCAGGGGTCTGCCCTCCTCAGG No data
1183211748_1183211755 6 Left 1183211748 22:36455424-36455446 CCACCCTGCAGGGGCTCAACTTG No data
Right 1183211755 22:36455453-36455475 CCCTGGGGCCTGCCTTCCCCAGG No data
1183211748_1183211758 8 Left 1183211748 22:36455424-36455446 CCACCCTGCAGGGGCTCAACTTG No data
Right 1183211758 22:36455455-36455477 CTGGGGCCTGCCTTCCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183211748 Original CRISPR CAAGTTGAGCCCCTGCAGGG TGG (reversed) Intergenic
No off target data available for this crispr