ID: 1183212345

View in Genome Browser
Species Human (GRCh38)
Location 22:36458653-36458675
Sequence GAAGCTAGCAAGTTTGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183212345_1183212348 0 Left 1183212345 22:36458653-36458675 CCTGCTCCAAACTTGCTAGCTTC No data
Right 1183212348 22:36458676-36458698 CTTCCCTATCTCAACATCATAGG No data
1183212345_1183212357 30 Left 1183212345 22:36458653-36458675 CCTGCTCCAAACTTGCTAGCTTC No data
Right 1183212357 22:36458706-36458728 CGAGATGGGAACTACTAATAGGG No data
1183212345_1183212356 29 Left 1183212345 22:36458653-36458675 CCTGCTCCAAACTTGCTAGCTTC No data
Right 1183212356 22:36458705-36458727 TCGAGATGGGAACTACTAATAGG No data
1183212345_1183212352 15 Left 1183212345 22:36458653-36458675 CCTGCTCCAAACTTGCTAGCTTC No data
Right 1183212352 22:36458691-36458713 ATCATAGGGACCCTTCGAGATGG No data
1183212345_1183212353 16 Left 1183212345 22:36458653-36458675 CCTGCTCCAAACTTGCTAGCTTC No data
Right 1183212353 22:36458692-36458714 TCATAGGGACCCTTCGAGATGGG No data
1183212345_1183212349 1 Left 1183212345 22:36458653-36458675 CCTGCTCCAAACTTGCTAGCTTC No data
Right 1183212349 22:36458677-36458699 TTCCCTATCTCAACATCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183212345 Original CRISPR GAAGCTAGCAAGTTTGGAGC AGG (reversed) Intergenic
No off target data available for this crispr