ID: 1183212349

View in Genome Browser
Species Human (GRCh38)
Location 22:36458677-36458699
Sequence TTCCCTATCTCAACATCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183212341_1183212349 26 Left 1183212341 22:36458628-36458650 CCTCTCTGGGCTTCCATTTCCCT No data
Right 1183212349 22:36458677-36458699 TTCCCTATCTCAACATCATAGGG No data
1183212342_1183212349 13 Left 1183212342 22:36458641-36458663 CCATTTCCCTCTCCTGCTCCAAA No data
Right 1183212349 22:36458677-36458699 TTCCCTATCTCAACATCATAGGG No data
1183212344_1183212349 6 Left 1183212344 22:36458648-36458670 CCTCTCCTGCTCCAAACTTGCTA No data
Right 1183212349 22:36458677-36458699 TTCCCTATCTCAACATCATAGGG No data
1183212340_1183212349 27 Left 1183212340 22:36458627-36458649 CCCTCTCTGGGCTTCCATTTCCC No data
Right 1183212349 22:36458677-36458699 TTCCCTATCTCAACATCATAGGG No data
1183212343_1183212349 7 Left 1183212343 22:36458647-36458669 CCCTCTCCTGCTCCAAACTTGCT No data
Right 1183212349 22:36458677-36458699 TTCCCTATCTCAACATCATAGGG No data
1183212345_1183212349 1 Left 1183212345 22:36458653-36458675 CCTGCTCCAAACTTGCTAGCTTC No data
Right 1183212349 22:36458677-36458699 TTCCCTATCTCAACATCATAGGG No data
1183212346_1183212349 -5 Left 1183212346 22:36458659-36458681 CCAAACTTGCTAGCTTCCTTCCC No data
Right 1183212349 22:36458677-36458699 TTCCCTATCTCAACATCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183212349 Original CRISPR TTCCCTATCTCAACATCATA GGG Intergenic
No off target data available for this crispr