ID: 1183212352

View in Genome Browser
Species Human (GRCh38)
Location 22:36458691-36458713
Sequence ATCATAGGGACCCTTCGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183212342_1183212352 27 Left 1183212342 22:36458641-36458663 CCATTTCCCTCTCCTGCTCCAAA No data
Right 1183212352 22:36458691-36458713 ATCATAGGGACCCTTCGAGATGG No data
1183212344_1183212352 20 Left 1183212344 22:36458648-36458670 CCTCTCCTGCTCCAAACTTGCTA No data
Right 1183212352 22:36458691-36458713 ATCATAGGGACCCTTCGAGATGG No data
1183212346_1183212352 9 Left 1183212346 22:36458659-36458681 CCAAACTTGCTAGCTTCCTTCCC No data
Right 1183212352 22:36458691-36458713 ATCATAGGGACCCTTCGAGATGG No data
1183212345_1183212352 15 Left 1183212345 22:36458653-36458675 CCTGCTCCAAACTTGCTAGCTTC No data
Right 1183212352 22:36458691-36458713 ATCATAGGGACCCTTCGAGATGG No data
1183212347_1183212352 -7 Left 1183212347 22:36458675-36458697 CCTTCCCTATCTCAACATCATAG No data
Right 1183212352 22:36458691-36458713 ATCATAGGGACCCTTCGAGATGG No data
1183212343_1183212352 21 Left 1183212343 22:36458647-36458669 CCCTCTCCTGCTCCAAACTTGCT No data
Right 1183212352 22:36458691-36458713 ATCATAGGGACCCTTCGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183212352 Original CRISPR ATCATAGGGACCCTTCGAGA TGG Intergenic
No off target data available for this crispr