ID: 1183212357

View in Genome Browser
Species Human (GRCh38)
Location 22:36458706-36458728
Sequence CGAGATGGGAACTACTAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183212346_1183212357 24 Left 1183212346 22:36458659-36458681 CCAAACTTGCTAGCTTCCTTCCC No data
Right 1183212357 22:36458706-36458728 CGAGATGGGAACTACTAATAGGG No data
1183212347_1183212357 8 Left 1183212347 22:36458675-36458697 CCTTCCCTATCTCAACATCATAG No data
Right 1183212357 22:36458706-36458728 CGAGATGGGAACTACTAATAGGG No data
1183212350_1183212357 4 Left 1183212350 22:36458679-36458701 CCCTATCTCAACATCATAGGGAC No data
Right 1183212357 22:36458706-36458728 CGAGATGGGAACTACTAATAGGG No data
1183212345_1183212357 30 Left 1183212345 22:36458653-36458675 CCTGCTCCAAACTTGCTAGCTTC No data
Right 1183212357 22:36458706-36458728 CGAGATGGGAACTACTAATAGGG No data
1183212351_1183212357 3 Left 1183212351 22:36458680-36458702 CCTATCTCAACATCATAGGGACC No data
Right 1183212357 22:36458706-36458728 CGAGATGGGAACTACTAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183212357 Original CRISPR CGAGATGGGAACTACTAATA GGG Intergenic
No off target data available for this crispr