ID: 1183216980

View in Genome Browser
Species Human (GRCh38)
Location 22:36487066-36487088
Sequence GACGTGCCTCCTCATGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 2, 2: 4, 3: 23, 4: 110}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183216973_1183216980 4 Left 1183216973 22:36487039-36487061 CCTGTGGCCACCGCAACAAGGCA 0: 1
1: 0
2: 10
3: 27
4: 171
Right 1183216980 22:36487066-36487088 GACGTGCCTCCTCATGGGAGAGG 0: 1
1: 2
2: 4
3: 23
4: 110
1183216976_1183216980 -3 Left 1183216976 22:36487046-36487068 CCACCGCAACAAGGCAGTGGGAC 0: 1
1: 4
2: 9
3: 19
4: 103
Right 1183216980 22:36487066-36487088 GACGTGCCTCCTCATGGGAGAGG 0: 1
1: 2
2: 4
3: 23
4: 110
1183216969_1183216980 11 Left 1183216969 22:36487032-36487054 CCTTACCCCTGTGGCCACCGCAA 0: 1
1: 1
2: 12
3: 34
4: 132
Right 1183216980 22:36487066-36487088 GACGTGCCTCCTCATGGGAGAGG 0: 1
1: 2
2: 4
3: 23
4: 110
1183216977_1183216980 -6 Left 1183216977 22:36487049-36487071 CCGCAACAAGGCAGTGGGACGTG 0: 2
1: 2
2: 4
3: 12
4: 88
Right 1183216980 22:36487066-36487088 GACGTGCCTCCTCATGGGAGAGG 0: 1
1: 2
2: 4
3: 23
4: 110
1183216972_1183216980 5 Left 1183216972 22:36487038-36487060 CCCTGTGGCCACCGCAACAAGGC 0: 1
1: 0
2: 10
3: 29
4: 156
Right 1183216980 22:36487066-36487088 GACGTGCCTCCTCATGGGAGAGG 0: 1
1: 2
2: 4
3: 23
4: 110
1183216970_1183216980 6 Left 1183216970 22:36487037-36487059 CCCCTGTGGCCACCGCAACAAGG 0: 1
1: 0
2: 5
3: 54
4: 379
Right 1183216980 22:36487066-36487088 GACGTGCCTCCTCATGGGAGAGG 0: 1
1: 2
2: 4
3: 23
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183216980 Original CRISPR GACGTGCCTCCTCATGGGAG AGG Intergenic
900018293 1:169772-169794 GAAGCACCTCCTCATGGCAGAGG + Intergenic
900048550 1:528368-528390 GAAGCACCTCCTCATGGCAGAGG + Intergenic
900070780 1:770220-770242 GAAGCACCTCCTCATGGCAGAGG + Intergenic
902231199 1:15028809-15028831 GAAGTGAAGCCTCATGGGAGAGG + Intronic
902546277 1:17192634-17192656 GACGTGCTCTCTCTTGGGAGAGG - Intergenic
903671417 1:25037927-25037949 GAGATGCATCCTCATGGCAGGGG - Intergenic
905920516 1:41715934-41715956 GAGGTGCCTTCACATGGAAGTGG + Intronic
913292461 1:117286468-117286490 GATCTGCCCCCTCATGGGGGTGG + Intergenic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
917603642 1:176602982-176603004 GACTTTCCTCCTCAGGTGAGTGG + Intronic
922106139 1:222515636-222515658 GAAGCACCTCCTCATGGCAGAGG + Intergenic
922989868 1:229897331-229897353 GATGTGTCTCTCCATGGGAGGGG + Intergenic
923526366 1:234775849-234775871 GACAGTCCTTCTCATGGGAGGGG + Intergenic
924348319 1:243093203-243093225 GAAGCACCTCCTCATGGCAGAGG + Intergenic
924735791 1:246754360-246754382 GGCATGCCTCCTCATGGGAGAGG + Intronic
1063176266 10:3553248-3553270 GACGGACTTCCTAATGGGAGGGG + Intergenic
1064176386 10:13079252-13079274 CGCGTGCCTCCTCATGAGAGAGG - Intronic
1066529067 10:36316388-36316410 GACAGGCCTCTTCCTGGGAGTGG + Intergenic
1066728043 10:38411698-38411720 GAAGCACCTCCTCATGGCAGAGG - Intergenic
1070855315 10:79603806-79603828 GATGTGCCTCTTCAGAGGAGGGG - Intergenic
1073130036 10:101182341-101182363 GAAGTGGCTCCTGATGGAAGGGG + Intergenic
1076519474 10:131071982-131072004 GAAGGGCTTCCTGATGGGAGTGG - Intergenic
1076974895 11:164968-164990 GAAGCACCTCCTCATGGCAGAGG + Intergenic
1082284310 11:50302487-50302509 GAAGCGCCTCCTCATGGCAGGGG - Intergenic
1083343463 11:61973721-61973743 GGAGTGCCTCCTCATGGAAATGG + Intergenic
1086566430 11:88231670-88231692 TATGTGCCTCCTCCTAGGAGAGG - Intergenic
1086986892 11:93260944-93260966 GGTGCGCCTCCTCACGGGAGAGG - Intergenic
1092548595 12:9473123-9473145 GAAATGCCTCCTTATTGGAGAGG + Intergenic
1094504405 12:31049326-31049348 GAAGTGCCTCCTTATTGGAGAGG - Intergenic
1105306104 13:19170157-19170179 GAGATGCCTCCTGCTGGGAGGGG - Intergenic
1107630042 13:42333856-42333878 GACGTCCCTACTCATGGCTGAGG - Intergenic
1113588540 13:111482364-111482386 GATGTGGCTCCTCATGGGCACGG - Intergenic
1114009038 14:18347889-18347911 GGTGCGCCTCCTCATGGGAGAGG - Intergenic
1117390409 14:55256856-55256878 GGTGTGTCTCCTTATGGGAGGGG - Intergenic
1122382215 14:101316352-101316374 GGTGTGCCTCCTCACAGGAGAGG - Intergenic
1123465478 15:20511698-20511720 GGCCTGCCTCCTCCAGGGAGGGG + Intergenic
1123652638 15:22489339-22489361 GGCCTGCCTCCTCCAGGGAGGGG - Intergenic
1123743062 15:23298198-23298220 GGCCTGCCTCCTCCAGGGAGGGG - Intergenic
1124276200 15:28327677-28327699 GGCCTGCCTCCTCCAGGGAGCGG + Intergenic
1124303704 15:28564032-28564054 CCCGTGCTTCCTCCTGGGAGAGG + Intergenic
1124306498 15:28583930-28583952 GGCCTGCCTCCTCCAGGGAGGGG - Intergenic
1124532602 15:30520509-30520531 GCTGTGCTTCCTCCTGGGAGAGG + Intergenic
1124766051 15:32487135-32487157 GCTGTGCTTCCTCCTGGGAGAGG - Intergenic
1124934958 15:34161368-34161390 GGCGTGCCTCCTCATGGGAGAGG + Intronic
1129736994 15:77972166-77972188 TACGTGCCTCCCCAGGGGAGCGG + Intergenic
1129849076 15:78781449-78781471 TACGTGCCTCCCCAATGGAGGGG - Intronic
1130134229 15:81168558-81168580 GATGTGGCTCCTCATGGTCGAGG - Intronic
1131003432 15:88956373-88956395 GAGGTGACTGATCATGGGAGCGG + Intergenic
1132338237 15:101062490-101062512 CAAGTGCATCCTCATGGGAATGG + Intronic
1132468843 16:90484-90506 GACGTGCCTTCTCACGGTGGGGG - Intronic
1132765794 16:1533555-1533577 GATGTGCTTCCTGATGGGAAAGG - Exonic
1134652879 16:15924862-15924884 GACGTGCTTCTTCAAGGGAGAGG - Intergenic
1137052106 16:35723122-35723144 GGGGTGCCTCCTCATGAGAGAGG + Intergenic
1137350097 16:47705954-47705976 GGCTTTCCTCCTCACGGGAGTGG + Intergenic
1137512677 16:49115200-49115222 GAAGAGCCACCTGATGGGAGAGG + Intergenic
1141605585 16:85151731-85151753 GAATTCCCTCCTCCTGGGAGAGG + Intergenic
1142445367 16:90132689-90132711 GAAGCACCTCCTCATGGCAGAGG - Intergenic
1142462144 17:102781-102803 GAAGCACCTCCTCATGGCAGAGG + Intergenic
1143917577 17:10305190-10305212 AAGGTGCCTCACCATGGGAGGGG + Intronic
1144167838 17:12629779-12629801 AAGCTGCTTCCTCATGGGAGGGG - Intergenic
1146275128 17:31511674-31511696 GAGGTGGCTCCCCATGGGGGAGG + Intronic
1147185375 17:38710573-38710595 GACTTGCCTAATCGTGGGAGTGG + Intronic
1147285676 17:39401388-39401410 CACGTCCCTCCTCATGGGGCCGG + Exonic
1148228625 17:45916968-45916990 GAGGTGCCATCTCATGGGAGAGG + Intronic
1148353569 17:46958614-46958636 GATGTGCCAGCTCAGGGGAGGGG + Intronic
1152805718 17:82355019-82355041 GAGGTGCTTCCACATGGCAGTGG + Intergenic
1153922350 18:9803138-9803160 GGCATTCCTCCTCATGGGAGAGG + Intronic
1154528431 18:15316000-15316022 GGTGCGCCTCCTCAAGGGAGAGG + Intergenic
1155959109 18:31978676-31978698 GATGCTTCTCCTCATGGGAGGGG + Intergenic
1157429623 18:47614056-47614078 GATCAGCCTCCTCCTGGGAGAGG + Intergenic
1160374546 18:78401526-78401548 GACGTGCCTCCAAAAGGGAGAGG - Intergenic
1160436995 18:78859326-78859348 GACGGGCCTTCCCATGGGTGTGG - Intergenic
1160651847 19:235148-235170 GAAGCACCTCCTCATGGCAGAGG + Intergenic
1161025686 19:2035689-2035711 GAAGGGTCTCCTCCTGGGAGAGG - Intergenic
1162035679 19:7937464-7937486 GCAGTGGCTCCTCCTGGGAGTGG - Intronic
1162500635 19:11051413-11051435 GAAGGGCCTCCTCAAGGCAGGGG - Intronic
930023974 2:47018960-47018982 GAAGTGCCTACTCATGGATGTGG + Intronic
932366010 2:71154020-71154042 GACGTCCTTCCTCCTAGGAGAGG + Intergenic
933650609 2:84847111-84847133 GACTTGGCTCCTCACTGGAGAGG - Intronic
933756693 2:85645069-85645091 CACGTGCTTCATCATGTGAGTGG + Exonic
935350943 2:102151519-102151541 GATGGGCCTCCTCATGGGTGTGG + Intronic
937057632 2:118952765-118952787 GTGGTGCCTCCTCATGAAAGAGG + Intronic
938527538 2:132147463-132147485 GGTGCGCCTCCTCAAGGGAGAGG + Intergenic
945173459 2:207019497-207019519 CAAGTGCCTCCTCCTGGGGGAGG - Intergenic
947051179 2:226045294-226045316 GACCTGCCAGCACATGGGAGTGG - Intergenic
948192508 2:236070801-236070823 GCAGTGCTTGCTCATGGGAGTGG + Intronic
1174753674 20:53137497-53137519 GACGTGGCTCCTTAATGGAGGGG - Intronic
1175740202 20:61414751-61414773 GAAGTCCCTCCAGATGGGAGAGG + Intronic
1180433538 22:15278699-15278721 GGTGCGCCTCCTCATGGGAGAGG - Intergenic
1180516097 22:16146608-16146630 GGTGCGCCTCCTCACGGGAGAGG - Intergenic
1183216980 22:36487066-36487088 GACGTGCCTCCTCATGGGAGAGG + Intergenic
1184041606 22:41947165-41947187 CACGTGCCTCCTTATAGGCGGGG + Intergenic
1184459485 22:44628855-44628877 GACGTGCTTCCACAGGGGAATGG + Intergenic
1185082865 22:48719267-48719289 GACGTGCCACCTCACCCGAGGGG - Intronic
949610552 3:5699151-5699173 GGCACGCCTTCTCATGGGAGAGG + Intergenic
950595077 3:13972739-13972761 GGCATGTCTCCTCATGGGAGAGG + Intronic
963442547 3:145357516-145357538 GACGTGTCTCCTCATGAGAGAGG + Intergenic
965322511 3:167266862-167266884 GGCGTGCCTTCTCACGGGAAAGG - Intronic
968365983 3:198184819-198184841 GAAGCACCTCCTCATGGCAGAGG - Intergenic
968806038 4:2773204-2773226 GACGCGGGTTCTCATGGGAGTGG - Intergenic
969350417 4:6595006-6595028 GTGGTGCCTCCTGCTGGGAGCGG + Intronic
969628410 4:8320576-8320598 GCCGTCCCTCCTCATGGGGGTGG + Intergenic
970234140 4:13941227-13941249 CAAGTGCTTCCTCATGGGATAGG + Intergenic
979255021 4:118599978-118600000 GAAGCACCTCCTCATGGCAGAGG - Intergenic
979333940 4:119446035-119446057 GAAGCGCCTCCTCATGGCAGAGG + Intergenic
981163052 4:141522070-141522092 GACGTGGCAGCTCATGGGAAGGG - Intergenic
984586315 4:181568793-181568815 GACGAGCCTGCTCTTGGGAGTGG - Intergenic
993197665 5:84769729-84769751 GACTGGTCTCCTCATGGAAGGGG - Intergenic
999553901 5:152720488-152720510 AACGTGTCTCCTCATGAGAGGGG - Intergenic
1002725209 5:181290044-181290066 GAAGCACCTCCTCATGGCAGAGG - Intergenic
1003246197 6:4384379-4384401 GATGTGCCTCCTCATGGGAGAGG - Intergenic
1003468997 6:6410963-6410985 GAAATGGCTCCTCATGGCAGAGG + Intergenic
1017889744 6:158628564-158628586 GACCTGTCTCCTCTTGAGAGGGG - Intronic
1017902484 6:158730524-158730546 GGGGCGCCTCCTCATGAGAGAGG - Intronic
1018378351 6:163234300-163234322 GGAGTGACTTCTCATGGGAGTGG + Intronic
1019496648 7:1343725-1343747 CACGTGCCTTTTCAGGGGAGGGG - Intergenic
1022300559 7:29098421-29098443 GAGGTGGCGCCTCATAGGAGGGG - Intronic
1023798112 7:43810710-43810732 GGCGCGCCTCCTCATGAGAGAGG - Intergenic
1024070119 7:45777667-45777689 GAAGCGCCTCCTCATGGCAGAGG - Intergenic
1025099314 7:56122304-56122326 GAAGCACCTCCTCATGGCAGAGG + Intergenic
1025187189 7:56870532-56870554 GAAGCACCTCCTCATGGCAGAGG + Intergenic
1025684733 7:63706385-63706407 GAAGCACCTCCTCATGGCAGAGG - Intergenic
1025990194 7:66491737-66491759 GAAGCGCCTCCTCATGGCAGAGG - Intergenic
1026038543 7:66846810-66846832 GAAGTGCCTCCTCATGGCAGAGG - Intergenic
1027212849 7:76164742-76164764 GAAGCGCCTCCTCATGGCAGAGG + Intergenic
1032047510 7:128621950-128621972 GAAGTGCCTCCTCATGGCAGAGG - Intergenic
1035169932 7:157011462-157011484 CACGTGCCTGCTCAGTGGAGCGG + Intergenic
1036105181 8:5830457-5830479 GGGGTGCCTCCTCATGAGAGAGG + Intergenic
1036813197 8:11881759-11881781 GACTTTCCTCCTCATGCCAGTGG + Intergenic
1046730725 8:117723118-117723140 GATGTGCCTCCTTTTGTGAGAGG - Intergenic
1049278546 8:141732210-141732232 GACGTGCCCCGTCCTCGGAGGGG + Intergenic
1049744132 8:144256006-144256028 GTGGTGCCTTCTCCTGGGAGTGG + Intronic
1055268865 9:74532997-74533019 GATGTGCTGCCTTATGGGAGTGG - Intronic
1055369530 9:75582378-75582400 GAGGTGCGGCCTAATGGGAGGGG + Intergenic
1057746744 9:97758466-97758488 GACGTGTCTCCTTGTGAGAGGGG + Intergenic
1062750352 9:138247686-138247708 GAAGCACCTCCTCATGGCAGAGG - Intergenic
1187104339 X:16224604-16224626 GAGGTGCTTGGTCATGGGAGTGG - Intergenic
1196542159 X:116922570-116922592 GTGGTTCCTCTTCATGGGAGAGG + Intergenic
1201061908 Y:10053558-10053580 AAAGTACCTCCTCAAGGGAGAGG + Intergenic
1202088619 Y:21164704-21164726 GACATGCCTCTTCATGAGAGGGG + Intergenic