ID: 1183217482

View in Genome Browser
Species Human (GRCh38)
Location 22:36490279-36490301
Sequence CAAAATGAGGAGAATGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 396}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183217482 Original CRISPR CAAAATGAGGAGAATGAGCC AGG Intronic
901043601 1:6381837-6381859 TAAAAGGAAGGGAATGAGCCGGG + Intronic
901043701 1:6382444-6382466 AAAAATGATTAAAATGAGCCTGG + Intronic
901990190 1:13106376-13106398 CAAAATTAGAAAAATTAGCCAGG + Intergenic
902593379 1:17491012-17491034 CCAAATTAGGAGAATGAGAGGGG + Intergenic
902926830 1:19701466-19701488 TAAAATGGGGAAAATGAGACTGG - Intronic
903122287 1:21224158-21224180 CTAAATGATGAGGAAGAGCCTGG - Intronic
903406654 1:23103090-23103112 AAAAATGAGAAAAATTAGCCAGG - Intronic
903748861 1:25606653-25606675 GAAAATGAGGATAATGATACTGG - Intergenic
904032343 1:27541056-27541078 CATAATGGGGAGAATGAACTGGG + Intronic
905076577 1:35276986-35277008 CAAAATGTGGAAAATTATCCTGG - Intronic
905260608 1:36715582-36715604 CAATATGAAGGGAATGTGCCAGG + Intergenic
905406113 1:37733512-37733534 CAAAAAGAGGAGCAAGGGCCAGG - Intronic
906366957 1:45218567-45218589 CAAAAACAGGAAAATTAGCCAGG - Intronic
908321658 1:62984511-62984533 TAAAATGGGGAGTATTAGCCAGG + Intergenic
908472972 1:64462442-64462464 AAAAATAAGCAGAATTAGCCAGG - Intergenic
908868126 1:68575876-68575898 TAAAATGAGGGAAGTGAGCCAGG + Intergenic
911531416 1:99047638-99047660 CAAACTGAGAAGAAGGAACCTGG - Intergenic
911771354 1:101746283-101746305 AAAAATGAAGAGAATGCTCCAGG + Intergenic
912856758 1:113176048-113176070 CTAACTTAGGAGTATGAGCCTGG - Intergenic
913454791 1:119019714-119019736 CAAAAGGAGGAAAAAGAGACTGG + Intergenic
915148410 1:153809458-153809480 AAGAATGAGGGGAAAGAGCCTGG - Exonic
915587270 1:156850850-156850872 TAAAATAAAAAGAATGAGCCAGG - Intronic
916316420 1:163453294-163453316 AAAAATCAGGAGATTGATCCAGG + Intergenic
916710792 1:167405525-167405547 AAAAATGAGCAAAATTAGCCAGG + Intronic
917002291 1:170373551-170373573 CAAAGGGAGGATAATGAGGCTGG + Intergenic
919441658 1:197641293-197641315 AAAAATGAGGAGGAGGAGCTGGG + Intronic
920265417 1:204717912-204717934 CCAGATGAGGGGAATGAGACAGG - Intergenic
920836511 1:209515649-209515671 GAAAATGAATAGAATAAGCCAGG - Intergenic
921676300 1:217980136-217980158 TAAAATGAGAAGAATGACACAGG - Intergenic
922160382 1:223075137-223075159 GAAAATGAGGAGCGTGCGCCTGG + Intergenic
923256714 1:232227877-232227899 CAAAAAGAGGAGAATGAAGAAGG + Intergenic
923342101 1:233016378-233016400 CAAAAAGAGGAGAAAGGGGCAGG - Intronic
924086094 1:240453627-240453649 GAAAAGGAGGAGAATGAGAGTGG + Intronic
924089119 1:240484753-240484775 CAAAAAGAGAAAAATTAGCCAGG + Intergenic
924148088 1:241097846-241097868 TAAAATGAGGAGACTGAGAGAGG - Intronic
924735504 1:246752073-246752095 AAAAAAAAGGAGAATTAGCCGGG - Intronic
1063041863 10:2349280-2349302 GAAAATGTTGATAATGAGCCTGG + Intergenic
1063517317 10:6709693-6709715 CAAAATGAGAAGAGAGAGCAGGG + Intergenic
1063550263 10:7025908-7025930 CAAAATGGGGAGAATGGGTGGGG + Intergenic
1064137466 10:12763460-12763482 CAAAATGAAGTGACTGAGACTGG + Intronic
1064768928 10:18703689-18703711 CAGAAAGCCGAGAATGAGCCTGG + Intergenic
1064859957 10:19816208-19816230 CAAAGTGTGGAGAAGGAGCGCGG + Intergenic
1065648282 10:27860290-27860312 CAAAATTAAAAGAATTAGCCAGG + Intronic
1065900150 10:30198973-30198995 CACAATGAGGACAAGCAGCCAGG + Intergenic
1066101402 10:32121727-32121749 CCAAGTGGGCAGAATGAGCCCGG - Intergenic
1067571418 10:47374148-47374170 CAAAATGAGGAGGCTGCACCAGG + Intronic
1068351145 10:55847180-55847202 CAAAAGTTGGAGAATGGGCCTGG + Intergenic
1068924244 10:62518277-62518299 AAAAATTATTAGAATGAGCCTGG - Intronic
1069871664 10:71536767-71536789 CACAATGAAGAGAAGGGGCCAGG + Intronic
1070466369 10:76727658-76727680 CAAAAAGAGGAGATTTAGGCTGG - Intergenic
1070737196 10:78871322-78871344 TAGAATGAAGAGAATGAGCAGGG - Intergenic
1072221839 10:93333545-93333567 TAAAATGAGAAGGATGAACCAGG + Intronic
1072239741 10:93484457-93484479 AAAAATCAGGAGAGTGGGCCAGG - Intergenic
1072461675 10:95624629-95624651 GAAAAAGAGGAGAAAGAGTCAGG + Intronic
1072536492 10:96368274-96368296 GAAAATGAGGAGGATGGGACAGG + Intronic
1072603873 10:96960830-96960852 TAAACTGAGAAGAAAGAGCCTGG - Intronic
1073777662 10:106804166-106804188 AAAAATGAGGAGAGTGTGCTTGG + Intronic
1075397355 10:122137290-122137312 AAAAAAAAGCAGAATGAGCCTGG + Intronic
1076439571 10:130471817-130471839 CTAAATGGGGAGAATTAGGCTGG + Intergenic
1077483204 11:2826272-2826294 AAAAATGAAGAAATTGAGCCGGG + Intronic
1079638777 11:22778541-22778563 GTAAATGATGAGAAGGAGCCAGG + Intronic
1079645985 11:22864324-22864346 CAAGAGGAGGAGGATGTGCCGGG - Intergenic
1083831310 11:65235613-65235635 GAAAATGAGGACAATGGGCCGGG + Intergenic
1084895534 11:72264859-72264881 CAAAAAGAAGAGATTGAGCGAGG - Intergenic
1085620784 11:78036603-78036625 CTAAAGTATGAGAATGAGCCAGG - Intronic
1085648109 11:78241050-78241072 CCAAATGAGGAGACTCAGTCAGG - Intronic
1085907135 11:80776856-80776878 ATAAATGAGGAGAATGAGGCAGG + Intergenic
1086121670 11:83311347-83311369 CAAAATTATGATAATGTGCCAGG + Intergenic
1086246401 11:84758395-84758417 TAAAATGAGGACAATAATCCTGG + Intronic
1088130600 11:106484634-106484656 CATGATGAGGAGAATGAGGATGG - Intergenic
1088301946 11:108367281-108367303 AAAAATGAGGGGAATGAGGCCGG - Exonic
1088478220 11:110266449-110266471 TAAAATGAGGAAAATGATCCAGG + Intronic
1090360588 11:126169848-126169870 GAGAATGATGGGAATGAGCCTGG - Intergenic
1090585426 11:128206823-128206845 CAAAAGGGGGAGAATGTGCCAGG - Intergenic
1091294090 11:134460357-134460379 GAGAGTGATGAGAATGAGCCGGG - Intergenic
1091733712 12:2901222-2901244 CTACTTGAGGAGAATGAGGCAGG - Intronic
1091770144 12:3146118-3146140 TAAAATGAGAAGATTGGGCCAGG + Intronic
1092034458 12:5319520-5319542 CAAAAATATAAGAATGAGCCAGG + Intergenic
1093166595 12:15810929-15810951 AAAAATAAGGAGAAATAGCCAGG - Intronic
1095969330 12:47891006-47891028 GAAAATAAGGAAAATAAGCCTGG - Intronic
1096299539 12:50414462-50414484 CAAAATCACAAGAATTAGCCAGG - Intronic
1096719572 12:53511119-53511141 ACAAATGAGAACAATGAGCCAGG - Intronic
1096855905 12:54482699-54482721 AAAAATGAGCAGAGTGGGCCGGG + Intergenic
1097252302 12:57642525-57642547 AAAAATGCGAAAAATGAGCCAGG + Intergenic
1097680050 12:62640507-62640529 AAAAATGATAAGAATGAGCTGGG + Intergenic
1098462268 12:70744761-70744783 AAATAAGAGGAGAATGAACCTGG + Intronic
1101342773 12:103857903-103857925 CAAAATGGGGATAATAGGCCAGG + Intergenic
1101695826 12:107125369-107125391 GAAATTGAAAAGAATGAGCCAGG + Intergenic
1102275047 12:111575467-111575489 CAAAATCAGAAGAATGGGCCTGG - Intronic
1106353946 13:28961174-28961196 GAAAATGAGGAGAAAGAGGATGG + Intronic
1106602902 13:31202322-31202344 CAGAATGAGAAGATTGAGTCAGG + Intronic
1108074774 13:46668487-46668509 CAAAATGTTGGAAATGAGCCCGG + Intronic
1108806360 13:54161652-54161674 CATAATAAGAAAAATGAGCCAGG + Intergenic
1109682416 13:65770073-65770095 CAAAATGAGAAGAATGACAGAGG - Intergenic
1110980502 13:81890578-81890600 CCAAGTGGGCAGAATGAGCCCGG + Intergenic
1111032716 13:82626445-82626467 CAAAATGAGATGAATGGACCAGG - Intergenic
1112106945 13:96251088-96251110 GAAAATGAGTAGAATGAGCTTGG + Intronic
1112230078 13:97580968-97580990 CAAAACTAGGATAATGAGGCCGG - Intergenic
1113845127 13:113383402-113383424 CACAAGGAGGAGAATGAAACTGG - Intergenic
1114119784 14:19658522-19658544 TAAAATTAGTAGAATGAGACAGG - Intergenic
1114310731 14:21464505-21464527 CCACAAGAAGAGAATGAGCCAGG + Intronic
1114519112 14:23321755-23321777 CAAGAGGAGGAGGAGGAGCCGGG + Exonic
1117116083 14:52514001-52514023 CAAAATCAGCAGAATGAGACAGG + Intronic
1117652805 14:57924420-57924442 GAAAGTAAAGAGAATGAGCCTGG - Intronic
1118162717 14:63306731-63306753 CAAATGTAGGAGAATGAGACTGG + Intergenic
1118336986 14:64861905-64861927 CACAATGAGGATGAAGAGCCAGG - Intronic
1119704900 14:76777311-76777333 CAAACTGAGGAGCAAGAGCCAGG - Intronic
1120957194 14:90093148-90093170 CAAGATGAGGAAACTGAGACAGG + Intronic
1121125500 14:91404159-91404181 CAAAATGCAGAGACTGACCCAGG + Intronic
1121160193 14:91731311-91731333 GAAAATAAGAAGAATGAGACTGG - Intronic
1121522543 14:94596151-94596173 CACAATGATAAGAGTGAGCCTGG + Intronic
1124081526 15:26502708-26502730 AAAAATGAGAAGAATGAGCAGGG + Intergenic
1124212117 15:27771578-27771600 CAAAGAGAGGAGAATGGGCGTGG + Intronic
1124845686 15:33287809-33287831 GAGAATGAGGAAAATGATCCAGG - Intergenic
1125053622 15:35331630-35331652 CAGAGTGAGGAGAATGAGACAGG + Intronic
1125414481 15:39438212-39438234 AAAAAAGAGGTGGATGAGCCTGG + Intergenic
1125983563 15:44027093-44027115 CAAACTGTGGACAATGACCCTGG + Intronic
1126351592 15:47750225-47750247 GATATTGAGGAGAAAGAGCCTGG + Intronic
1126814521 15:52441688-52441710 CCAAATGAGGAGAAGAAGTCAGG - Intronic
1126815541 15:52449838-52449860 AAAAATGAACAGAATTAGCCAGG + Intronic
1127050178 15:55074572-55074594 AAAAAAGAGAAAAATGAGCCAGG + Intergenic
1127486449 15:59422225-59422247 CAAAATAAAAAGAATTAGCCAGG + Intronic
1127720880 15:61698121-61698143 CAAAATGAAGAAAATGAGACTGG + Intergenic
1127918089 15:63471908-63471930 GAAAGTGAGGAGGACGAGCCAGG + Intergenic
1129142420 15:73612257-73612279 AAAAATGTGAAGAATTAGCCAGG + Intronic
1129445844 15:75617302-75617324 TAAAGAGAGGAGAATGAGGCAGG - Intronic
1129706016 15:77795042-77795064 AAAAATGAGGACAATACGCCAGG + Intronic
1130540777 15:84819467-84819489 CAAAGTGGGGAGAATGTGACTGG + Intronic
1133085774 16:3361968-3361990 CAAAATTAGAAAAATGGGCCAGG + Intergenic
1133404132 16:5509605-5509627 GAAAATGAGGAGAATTTGCAAGG - Intergenic
1133743194 16:8667089-8667111 GAAAATCAGGAGACAGAGCCGGG - Intergenic
1134288745 16:12885989-12886011 AAAAATGAGTAGAATGTCCCAGG - Intergenic
1134821801 16:17252985-17253007 CTAAATGAGGAGATGGAGACAGG - Intronic
1135712999 16:24733877-24733899 CAAAAAGAGGTGAGTGAGGCTGG + Intronic
1136582556 16:31162060-31162082 AAAAATAAGGACAATGCGCCGGG + Intergenic
1136598386 16:31267127-31267149 CAAAGTGCTGGGAATGAGCCAGG + Intronic
1136859252 16:33687142-33687164 CCAAGTGATGAGAATGAACCCGG + Intergenic
1137541883 16:49368774-49368796 AAAAATAAGGAAAATTAGCCAGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137650870 16:50119219-50119241 CAAAATCAAGAAAATTAGCCAGG + Intergenic
1138380214 16:56595554-56595576 AAAAATGATCATAATGAGCCAGG + Intergenic
1139326914 16:66159921-66159943 CACCATGAGAAGACTGAGCCTGG - Intergenic
1139686598 16:68608844-68608866 CAAAATAGAGGGAATGAGCCAGG + Intergenic
1139718713 16:68835613-68835635 CAAAACGTGGAGAAAGAGGCCGG + Intergenic
1141244046 16:82290108-82290130 CAAAGTGAGGAAAATGAACAGGG - Intergenic
1142048442 16:87941552-87941574 TAAAAATAGAAGAATGAGCCGGG + Intergenic
1203120761 16_KI270728v1_random:1535329-1535351 CCAAGTGATGAGAATGAACCCGG + Intergenic
1143574599 17:7783635-7783657 CAACATGGTGAAAATGAGCCAGG + Intronic
1143601862 17:7952186-7952208 GATAATGAGGAGAATGAACTGGG - Intergenic
1143919005 17:10315883-10315905 CAAAATGGTGAGAATGGGCAGGG - Exonic
1144136733 17:12302306-12302328 AAAAATGATGAAAATGGGCCAGG - Intergenic
1146234957 17:31150620-31150642 CAAAATGAGGAGAGGGAGGGTGG - Intronic
1146478209 17:33180320-33180342 CACAATGAGGGGAAGGAGCATGG + Intronic
1147564804 17:41529489-41529511 CAAAATGAGGAAGCAGAGCCTGG + Intergenic
1147801154 17:43089329-43089351 AAAAATTAGGAGAAAGAGCCTGG + Intronic
1147879592 17:43645470-43645492 TAAAATGAGGAAAATGGACCGGG - Intronic
1148558410 17:48592238-48592260 CAAATTGAAAAGTATGAGCCTGG - Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148753602 17:49960338-49960360 ACAAATGAGGAGACTGGGCCGGG - Intergenic
1148884245 17:50760040-50760062 AAAAATGAGGACAATTGGCCGGG + Intergenic
1149091277 17:52784239-52784261 AAAAATGAAAAAAATGAGCCTGG - Intergenic
1149171907 17:53822357-53822379 CAAAATGAGTAGAATGTAGCAGG - Intergenic
1149185378 17:53991329-53991351 AAAAAAGAGGAAAATGAGGCAGG - Intergenic
1149773017 17:59335843-59335865 AAAAATTTGGAGAAAGAGCCAGG - Intronic
1150978091 17:70111340-70111362 CAAAAAGAGGAGATGGAGCTGGG + Intronic
1152581466 17:81167130-81167152 AAAAATTAGAAAAATGAGCCAGG + Intergenic
1152985254 18:315176-315198 GAGAATGAAGAGAATGAGTCTGG + Intergenic
1153277668 18:3383881-3383903 CAAAATGTAAAGAATTAGCCAGG + Intergenic
1153788766 18:8558334-8558356 CAGATTCAGGAGAATCAGCCAGG - Intergenic
1156168300 18:34450639-34450661 AAAAATGAAAAAAATGAGCCTGG - Intergenic
1156424446 18:36994686-36994708 TAAAATAAGCAGAATGAGTCAGG - Intronic
1157618293 18:49000961-49000983 CAAAAAGAGACTAATGAGCCTGG - Intergenic
1159565502 18:70043390-70043412 CAATATTAGGAGAATGAGAAGGG + Intronic
1159863239 18:73673972-73673994 GAAAATGTACAGAATGAGCCTGG - Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1161034173 19:2075187-2075209 AAAAATGAAAAAAATGAGCCAGG - Intronic
1161232693 19:3182663-3182685 TAAAAATAGGAAAATGAGCCAGG - Intergenic
1161270307 19:3386000-3386022 CAGAATGAGGAGGATGGGCCGGG - Intronic
1162005256 19:7774184-7774206 CTAAATGGGGAGACTGGGCCGGG + Intergenic
1162268773 19:9597184-9597206 CTGAATGAGCAGAATGAGTCAGG + Intergenic
1162757633 19:12869755-12869777 CAAAATGGGGAGAATAGGCCAGG + Intronic
1162831733 19:13288849-13288871 TAAAATGAGGAGAATGGTGCTGG - Intronic
1163021459 19:14482909-14482931 GAAAATGAGGAGGCTGAGCCAGG - Exonic
1163483054 19:17569730-17569752 GAAAATTAGGAGAATGGCCCAGG - Intronic
1164053813 19:21605482-21605504 AAGAATAAGGAGAATGGGCCGGG + Intergenic
1164790969 19:30980369-30980391 CCCAAAGAGGAGAATGAACCAGG - Intergenic
1165350969 19:35275340-35275362 CAAAGTGAGTAGAAGGGGCCGGG - Intronic
1166093525 19:40525528-40525550 CAAAACGAGGAGGAGGAGCCCGG + Intronic
1167409063 19:49334323-49334345 AAAAATGAAGAAAATTAGCCAGG + Intergenic
1167631917 19:50630717-50630739 TGAAATGGGGAGAATGAGGCTGG - Intronic
1167909237 19:52688563-52688585 CAAAATGAGGAGCAGAACCCCGG - Intronic
1167958795 19:53089840-53089862 CAAAATGAGGAGCAGAAACCTGG - Intronic
1168050420 19:53825604-53825626 CAAAAAAAAGAGAATTAGCCAGG - Intergenic
924998040 2:382036-382058 CAAAGTGTGGAGAATTAGCCCGG + Intergenic
926014470 2:9437241-9437263 CAAAAATAGAAAAATGAGCCAGG + Intronic
926258008 2:11226749-11226771 AAAAATGAGAAAAATCAGCCGGG + Intronic
928521543 2:32094016-32094038 GAAAATGGAGAGAATGATCCTGG - Intronic
930350890 2:50252852-50252874 CTAAATGAAGAGAATAAACCTGG - Intronic
932259362 2:70314066-70314088 CAAAATGCTGAGATTGAGGCAGG + Intergenic
933490708 2:82982995-82983017 CAAAATGAAAAGAATAAACCTGG + Intergenic
934151893 2:89154931-89154953 CAGAATAACGGGAATGAGCCTGG - Intergenic
934215367 2:90026976-90026998 CAGAATAACGGGAATGAGCCTGG + Intergenic
934931183 2:98425456-98425478 CAAAATGAGTAAAATGGGGCAGG + Intergenic
934957118 2:98631947-98631969 CAAAAATAGAAAAATGAGCCAGG + Intronic
936270084 2:111042623-111042645 CAATATTGAGAGAATGAGCCTGG + Intronic
936547922 2:113408742-113408764 CACAATGATGAGTCTGAGCCTGG + Intergenic
937339896 2:121084469-121084491 CAAAATGAAGTGACTTAGCCGGG + Intergenic
937727426 2:125183900-125183922 CAAAATAGGGAGAAGAAGCCAGG - Intergenic
938623166 2:133078622-133078644 CAAGACAAGGAGAATGAGACAGG + Intronic
939395343 2:141622184-141622206 TAAAATGAGAGTAATGAGCCAGG - Intronic
939986768 2:148836612-148836634 CAAGATGAGGAAAAAGAACCTGG - Intergenic
940679666 2:156770158-156770180 GAAAGTGAGGAGAAAGAGACAGG + Intergenic
941291978 2:163687527-163687549 CAAAATGAGGTAACTGAGACTGG + Intronic
943175215 2:184464407-184464429 AAAAATAATGAGACTGAGCCAGG + Intergenic
943386255 2:187206972-187206994 CAAAATGAAGAGAAGGAGTTGGG + Intergenic
944191894 2:197012025-197012047 CACTATGAGGAGCAAGAGCCAGG - Intronic
944583604 2:201154382-201154404 GAAAATGGAGAGAATAAGCCAGG - Intronic
946227828 2:218273791-218273813 CAAAATGAGGAAACTGGGCCTGG - Intronic
946953180 2:224899307-224899329 CAAAATGAGGAGACTGGGCTAGG - Intronic
947808202 2:232982840-232982862 CAAAGTGGGGAGAGTGAGACAGG + Intronic
948506675 2:238433039-238433061 AAAAATTAGCAGATTGAGCCAGG - Intronic
1169774113 20:9233598-9233620 CCAAATGATGAGAAAGAGCCAGG + Intronic
1170112771 20:12823269-12823291 AAAAATGAGAAGATTGTGCCAGG + Intergenic
1170462414 20:16589640-16589662 CAAAATGAGGAATATAGGCCGGG - Intergenic
1170724294 20:18912418-18912440 AAAAAAGAAGAGAATCAGCCAGG - Intergenic
1171136842 20:22702302-22702324 CATGAGGAGGAGAATAAGCCAGG - Intergenic
1172219643 20:33264681-33264703 CAAAATATGAAAAATGAGCCAGG + Intergenic
1172336223 20:34118248-34118270 CAGAAGGAGAAGAATAAGCCAGG + Intergenic
1172460366 20:35113776-35113798 CAAAATTAGGAAAATTAGCCAGG + Intergenic
1174251214 20:49220953-49220975 AAAAATGAAGTGAATGAGACTGG - Intronic
1175227365 20:57452437-57452459 CTGAATGGAGAGAATGAGCCAGG + Intergenic
1175324608 20:58114395-58114417 CACCAAGAAGAGAATGAGCCCGG + Intergenic
1177597134 21:23259107-23259129 CAAAATCAGCAAAATGAGGCAGG + Intergenic
1178529647 21:33364968-33364990 AAAAATGAACAGAATTAGCCAGG + Intergenic
1179303827 21:40136813-40136835 CAGAATGAGGAAGAGGAGCCTGG + Intronic
1180152787 21:45960285-45960307 CAAGATGATGAGTCTGAGCCTGG + Intergenic
1180462961 22:15583563-15583585 TAAAATTAGTAGAATGAGACAGG + Intergenic
1180589744 22:16927018-16927040 CACAATGATGAGTCTGAGCCTGG - Intergenic
1180604666 22:17048421-17048443 GAATTTGAGGAGAATGAGACTGG + Intergenic
1181152071 22:20891666-20891688 CAAAATGATGAGCTAGAGCCAGG + Intergenic
1182115162 22:27752210-27752232 CATAAGGAGGTGCATGAGCCGGG - Intronic
1182148058 22:28009547-28009569 CAGAAGCAGGAGAATGATCCAGG + Intronic
1182432471 22:30308089-30308111 TAAAATGGGGAGAATGGGCCGGG - Intronic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1183217482 22:36490279-36490301 CAAAATGAGGAGAATGAGCCAGG + Intronic
1184899424 22:47435233-47435255 CACAAGGAGGAGACAGAGCCAGG + Intergenic
1184976701 22:48067325-48067347 CCACATGAGGAGAAGGGGCCAGG - Intergenic
1185141942 22:49107532-49107554 AAAAATTCGGAGACTGAGCCTGG - Intergenic
949490870 3:4587564-4587586 CAAAATGAGAAGTGTGGGCCGGG - Intronic
951188953 3:19747083-19747105 CAAAATGAGGTTAAAGAGCTAGG + Intergenic
951219312 3:20052813-20052835 CAAAAAGACGAAAATTAGCCAGG + Intronic
951349425 3:21587442-21587464 CCAAATGAGAAGAATGAGCCTGG - Intronic
951864634 3:27294408-27294430 CAAAATGACATGAAGGAGCCAGG + Intronic
952130157 3:30352774-30352796 CAGAAAGAGGAAAATGAGACAGG + Intergenic
953288261 3:41634430-41634452 CAAAAAGAGTATAATGAGTCAGG + Intronic
955699274 3:61667574-61667596 CAAAATGCCGAGCATGAGTCAGG - Intronic
955862760 3:63349735-63349757 CAAAATGAGTAGAAGGAACTTGG - Intronic
955887765 3:63618913-63618935 CAAAGTGGGGAGAATGAGACAGG + Intergenic
956147334 3:66204128-66204150 GAAAATCACGAGAATGGGCCGGG + Intronic
956188945 3:66589921-66589943 GAAAGAGAGCAGAATGAGCCAGG - Intergenic
956959291 3:74379400-74379422 AAAAATGAAGACAATGAGGCAGG - Intronic
958638113 3:96771339-96771361 AAAAATGTGGAGAATAACCCAGG + Intergenic
959130137 3:102344753-102344775 CTAAATGACAAGAAGGAGCCTGG + Intronic
959713043 3:109403863-109403885 CACAATTAGGAAAATTAGCCAGG - Intergenic
960262815 3:115587956-115587978 CATCATTAGGAGAATGAGCAGGG - Intergenic
960529920 3:118753007-118753029 GAAAATGAGGAGAAGGAGAAAGG + Intergenic
961986739 3:131142397-131142419 CAAAAGTAGTAGAATGTGCCAGG - Intronic
962336615 3:134537588-134537610 CAAGATGAGGAGAGTGAACATGG - Intronic
963752408 3:149196531-149196553 GAAAATGTGCAAAATGAGCCTGG + Intronic
963846640 3:150165563-150165585 CAAAAAGAGAACAATGGGCCAGG - Intergenic
964230997 3:154467863-154467885 CTAAATGATGAGAAGCAGCCAGG - Intergenic
964321330 3:155500848-155500870 CAACATGCAGAGAATGAGCTGGG + Intronic
964413501 3:156423812-156423834 CAGAGTCAGGAAAATGAGCCAGG + Intronic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
966494678 3:180566548-180566570 TAAAATGAGGGGAGGGAGCCAGG - Intergenic
967217477 3:187222771-187222793 CAAATTGGCCAGAATGAGCCAGG - Intronic
968268105 3:197378163-197378185 GACGATGAGGAGAATGAGCCAGG - Intergenic
968332129 3:197879846-197879868 TAAATAGAGGAGAATGAGTCAGG + Intronic
969452937 4:7285326-7285348 CAACATGAGGAGATGGGGCCGGG - Intronic
970648645 4:18152739-18152761 TAAACTCAGGAGAATGAGGCAGG + Intergenic
970895761 4:21102013-21102035 CTAAATCACAAGAATGAGCCTGG + Intronic
971311995 4:25533095-25533117 CAGAATGACAAGAATGGGCCGGG - Intergenic
971548421 4:27917031-27917053 CTAAATGACAAGAATAAGCCAGG - Intergenic
971638497 4:29097158-29097180 CCAAACTAAGAGAATGAGCCTGG + Intergenic
971651283 4:29278737-29278759 CAAAATGAAAAGAAATAGCCAGG + Intergenic
972473206 4:39426844-39426866 AAAAATTAAGAAAATGAGCCAGG - Intronic
974015663 4:56646651-56646673 CAAAATGAAGAGAAAGAGGGAGG - Intergenic
974153266 4:58037983-58038005 CAAAATGAGAAGAATGGATCTGG - Intergenic
977305378 4:95317785-95317807 CCAAATGAGGAAAAACAGCCAGG + Intronic
977344872 4:95804825-95804847 CAAAATTACGAAAATTAGCCGGG + Intergenic
978297946 4:107230545-107230567 CTAAATTAGGAGAATGAGGTTGG - Intronic
978784967 4:112599388-112599410 AAAAATGAGAAGAATGAGGTGGG + Intronic
979071769 4:116216821-116216843 CAGAATGTGGACAATAAGCCTGG - Intergenic
979832532 4:125318500-125318522 CACATTAAGGAGAATGAGCCTGG + Exonic
981965433 4:150595253-150595275 GATAATTAGGAGAATAAGCCAGG + Intronic
983740908 4:171132439-171132461 CAAAATAATGAGAATAAGACAGG - Intergenic
983758908 4:171380290-171380312 GAAAATGAGGGAAATGAGTCTGG + Intergenic
984361488 4:178740638-178740660 CAAATTGAACAGAATTAGCCAGG - Intergenic
984841637 4:184073573-184073595 AAAAATGAGCATAATGAGCCTGG + Intergenic
984971913 4:185199209-185199231 CAAAAAGAGAAAAATTAGCCAGG + Intronic
985182220 4:187277417-187277439 TAATATGAGGAGAAGGAGGCTGG - Intergenic
985266707 4:188157897-188157919 AAAAATAAAAAGAATGAGCCAGG + Intergenic
986410700 5:7475796-7475818 CGAAATGAGGAGACTGTGGCGGG + Intronic
986633674 5:9799366-9799388 CAAGGTGAGGAGATTTAGCCAGG + Intergenic
986663400 5:10078995-10079017 TAAAATGGGGAGAAAGGGCCAGG + Intergenic
988179515 5:27772014-27772036 AAAAATGTGGAAAATGGGCCAGG + Intergenic
990037433 5:51338663-51338685 AAAAATAAGGAAAATTAGCCAGG - Intergenic
990056144 5:51581176-51581198 CAAATGTAGGAGAATGAACCAGG + Intergenic
990665474 5:58067345-58067367 TAAAATTAGGAGATTTAGCCTGG - Intergenic
990714291 5:58619385-58619407 CAAAAGGAAGAGAATGAATCAGG - Intronic
990908948 5:60834505-60834527 TAAAATAAGAAGCATGAGCCAGG + Intronic
991172247 5:63641973-63641995 CAAAATCAAGAAAATTAGCCAGG + Intergenic
992532725 5:77667783-77667805 CCAAATCAAGAGAATGAGGCAGG + Intergenic
994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG + Intronic
994812299 5:104536255-104536277 CAATAGAAGGAGAATGTGCCTGG - Intergenic
995669641 5:114587725-114587747 TAAAATGAGAAGTATGAGCGTGG + Intergenic
996410985 5:123158803-123158825 AAAAATGAGGAGACTGAGACTGG - Intronic
997008895 5:129853302-129853324 TAATAGGAGGAGAATGAGACTGG + Intergenic
997497818 5:134345344-134345366 CAACATGTGAAAAATGAGCCTGG + Intronic
998087312 5:139336964-139336986 CAAAATCAGGAAAATGAACTAGG - Intergenic
998642274 5:144024599-144024621 CAAGATGAGGAGGAAGAGTCAGG + Intergenic
998859458 5:146428423-146428445 CAAGAGGAGGAGACAGAGCCAGG + Intergenic
999093693 5:148959084-148959106 CAAGATCTGGAGGATGAGCCAGG - Intronic
999891934 5:155987381-155987403 CCAAACGAGGACAGTGAGCCTGG - Intronic
1000318055 5:160111964-160111986 CAAAATGACGCAAATTAGCCAGG + Intronic
1000788912 5:165581202-165581224 TAACATGAAGAGTATGAGCCTGG + Intergenic
1001287238 5:170432730-170432752 CAAAATGTAGGGAAAGAGCCCGG - Intronic
1001314614 5:170633316-170633338 GAAGATGAGGAAAATGAGCAGGG + Intronic
1001701618 5:173710732-173710754 CAAGATGTGGAGACTGGGCCGGG - Intergenic
1002308579 5:178298750-178298772 CTAAAGGAGCAGAATGGGCCAGG + Intronic
1003003378 6:2358277-2358299 AAAAATGATGAAGATGAGCCGGG - Intergenic
1003850315 6:10215560-10215582 CAAAAAGAAGAGAAAGATCCAGG + Intergenic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004649723 6:17597955-17597977 AAAAATGAAAAAAATGAGCCGGG + Intergenic
1006656078 6:35594191-35594213 CAAAATGAAAAAAATCAGCCAGG + Intronic
1007421676 6:41723550-41723572 GGAAATGAGGAAACTGAGCCCGG - Intronic
1008410925 6:51178984-51179006 AAAAATGAGGAGAATGAAGGGGG - Intergenic
1008468513 6:51856999-51857021 CCAAATGAGGAGACTGAGGCAGG + Intronic
1008868530 6:56245032-56245054 CAAAATGAGGACACAGAGCAAGG - Intronic
1010131479 6:72499494-72499516 CAGAATGGGGAGAACAAGCCAGG + Intergenic
1013091656 6:106905808-106905830 CAAAAATACAAGAATGAGCCTGG + Intergenic
1013835646 6:114332273-114332295 GAAAATGGGGACAATGTGCCTGG - Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017244225 6:152204964-152204986 CAAAAGGAAGAAAATGAACCTGG + Intronic
1017585460 6:155917045-155917067 CAATATGATGAGAAAGAGGCAGG + Intergenic
1017822373 6:158059094-158059116 CAAATCGTGGAAAATGAGCCTGG - Intronic
1019227597 6:170527128-170527150 CTAACTGAGGAGTATGAACCCGG - Intergenic
1019603513 7:1897140-1897162 CAGAAGGAGGAGGAAGAGCCGGG + Intronic
1021037887 7:15823630-15823652 AAAAATGAATAAAATGAGCCTGG + Intergenic
1021939520 7:25665873-25665895 AAGCAAGAGGAGAATGAGCCAGG + Intergenic
1022025681 7:26445636-26445658 TAAAATGAAGATAATGGGCCAGG + Intergenic
1022165326 7:27754314-27754336 GAAAATGAGTGGAATGAGACAGG - Intronic
1022495349 7:30849846-30849868 CAAAATAAGGACAATGTGGCTGG - Intronic
1022523344 7:31021885-31021907 AGAAAAGAGGAGAATGAGCCTGG + Intergenic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1023558141 7:41444815-41444837 CAAAATGAGGAGAAGGTGCCAGG - Intergenic
1023658201 7:42447397-42447419 CAGAAGGAGGAGAAAGATCCTGG - Intergenic
1024267357 7:47616996-47617018 AAAAATGAAGATAATTAGCCAGG + Intergenic
1025794304 7:64723627-64723649 CAAAATGAGGAAGGTGAGGCTGG + Intergenic
1027220735 7:76212307-76212329 CAAAATTAGCAAAATTAGCCAGG - Intronic
1028570996 7:92286769-92286791 TAAAATAAGGATAATAAGCCAGG - Intronic
1028819702 7:95193083-95193105 CCACATGAGGAAAATGAGGCAGG + Intronic
1029250961 7:99236057-99236079 CAAGAGGAGGAGAAAGCGCCTGG + Intergenic
1030208090 7:106970075-106970097 CAAAATTTAGAGAATGGGCCAGG + Intergenic
1030504070 7:110397796-110397818 CAAAATCATGAGATTGAGTCAGG + Intergenic
1031121712 7:117729702-117729724 AAAAATGAGGAAATTGAGCCAGG + Intronic
1031984730 7:128156548-128156570 AAAAATCAGGACAATCAGCCAGG + Intergenic
1032210454 7:129909558-129909580 CAAAAAGAGAAAAATGGGCCGGG + Intronic
1033041252 7:137920314-137920336 CAGCATGAGAAGAATGAGCTAGG + Intronic
1033644161 7:143288198-143288220 CAAAAGGAGGGGAAGGAGCGGGG - Exonic
1033693959 7:143767772-143767794 CAAAAACAGGAAAATTAGCCAGG - Intergenic
1034429168 7:151032398-151032420 CAAAATGTGTAGAATAGGCCAGG + Intronic
1037024940 8:14023725-14023747 AAAAACTAGGAGAAGGAGCCAGG + Intergenic
1038982860 8:32778354-32778376 CATAATGAAGAGAATGATCAAGG + Intergenic
1039397975 8:37243748-37243770 AAAAATGAGGAAAAAGAGCAGGG - Intergenic
1039511638 8:38096629-38096651 AAAAATAAGAAAAATGAGCCAGG + Intergenic
1039799424 8:40941546-40941568 GAGAATCAGGAGAATGAACCTGG - Intergenic
1040823828 8:51595834-51595856 AAAAAAGAGGAAAATGAGCAAGG + Intronic
1041390050 8:57339744-57339766 CAAGATCAAGGGAATGAGCCTGG + Intergenic
1043043566 8:75293080-75293102 CATACTGAGGAAAATGAGCTGGG - Intergenic
1043237242 8:77883343-77883365 AAAAATGACGAGATTGAGGCTGG + Intergenic
1043451454 8:80371581-80371603 CAAAATGTGTAGCTTGAGCCGGG + Intergenic
1045099285 8:98828269-98828291 CAAAAAGATGGGAGTGAGCCTGG - Intronic
1045206259 8:100044215-100044237 CAGAATGAGCAGAATGAGTTGGG - Intronic
1045716743 8:105055927-105055949 GAAACTGAGGATCATGAGCCTGG - Intronic
1046468636 8:114638568-114638590 CAAATTCAAGACAATGAGCCAGG + Intergenic
1046587734 8:116168292-116168314 CAAAGTCAGGAGAAATAGCCTGG - Intergenic
1046725280 8:117667252-117667274 CAAAATGAGAAAAATGAGTTGGG - Intergenic
1046858961 8:119068772-119068794 CAAAATGAAGTGAGTGATCCTGG + Intronic
1047319045 8:123762240-123762262 TAAAATGAGGAGACTGAACAAGG - Intergenic
1047409312 8:124611255-124611277 CAAGATTGGGAGAAAGAGCCAGG + Intronic
1047954662 8:129964721-129964743 CAAAATGAAAAAAGTGAGCCAGG + Intronic
1048119655 8:131564679-131564701 AAAAATGAGCAAAATTAGCCAGG + Intergenic
1048468726 8:134688558-134688580 CAAAAGGAAGAAAAGGAGCCAGG + Intronic
1050357141 9:4793592-4793614 CGAAATATGGTGAATGAGCCGGG + Intronic
1050702242 9:8353591-8353613 AAATATAAGGAAAATGAGCCGGG - Intronic
1050830861 9:10010477-10010499 AAAAATGAGGAAAATGAGGGAGG + Intronic
1052011458 9:23415063-23415085 GAAAATGAAGAGACTGTGCCTGG + Intergenic
1053944849 9:43296390-43296412 CAAAATGGGGAAGATGAGTCGGG + Intergenic
1055597354 9:77879091-77879113 TAAGATGAGGAAAATGAGCATGG + Intronic
1056856507 9:90134486-90134508 AAAAAGGAAGAGAAAGAGCCCGG - Intergenic
1058210572 9:102163399-102163421 CAAAATGACGGGATTGAGACTGG - Intergenic
1059643265 9:116238012-116238034 CAAATTGAGAAGAACTAGCCAGG - Intronic
1060045589 9:120337545-120337567 CATAATGAGCAGAACGAGTCTGG - Intergenic
1060544627 9:124452799-124452821 CAATATTTGCAGAATGAGCCGGG + Intronic
1062415521 9:136447383-136447405 CAAATTGAGGTGAACGCGCCAGG + Intronic
1062678518 9:137763124-137763146 CAAAGTGAGTAGATTGAGGCAGG + Intronic
1203581328 Un_KI270746v1:8722-8744 CAAAATGGGGAAAATGAGTGGGG - Intergenic
1203587984 Un_KI270747v1:24968-24990 CAAAATGGGGAAGATGAGTCGGG + Intergenic
1187207837 X:17199670-17199692 CAAAATGAGGACAATGATGATGG + Intergenic
1187253848 X:17623435-17623457 TGAAAGGAGGAGAAAGAGCCTGG - Intronic
1188314414 X:28656205-28656227 CTAAAGGAGGAGAATGACCAGGG - Intronic
1189399268 X:40650694-40650716 CACAATGAGGGGAATGGACCAGG + Exonic
1189402423 X:40683734-40683756 CAAAGTGGGGATAATGAACCTGG - Intronic
1190330930 X:49234858-49234880 TAAAATGAGAAAAATTAGCCAGG - Intergenic
1191709982 X:64139444-64139466 CTGAAGGAGGAGAAAGAGCCAGG - Intergenic
1191768190 X:64724329-64724351 AAAAATAAAGAGACTGAGCCCGG - Intergenic
1192497387 X:71625102-71625124 AAAAAAAAGGAGAATAAGCCAGG + Intergenic
1192597234 X:72423969-72423991 CAGAATGAAGATAATAAGCCAGG - Intronic
1193356905 X:80530246-80530268 CAAAAATAGGAAAATTAGCCTGG + Intergenic
1193428467 X:81370258-81370280 CCAGATGAGGAGATTGAGACTGG - Intergenic
1193588198 X:83353661-83353683 AAAAAGGAGGAGAATGAGAATGG + Intergenic
1194178092 X:90677223-90677245 AAAAATGAGAAAAATGGGCCGGG + Intergenic
1194345564 X:92759936-92759958 CAAAATGTACAAAATGAGCCTGG - Intergenic
1194978223 X:100413962-100413984 TAAAATGAAAAGAATGAGCCAGG - Intergenic
1197055005 X:122107769-122107791 TAAAAGGAGGAGAATGACCCAGG - Intergenic
1197714930 X:129699808-129699830 CAAAATGAGGAGAGTGGTGCAGG - Intergenic
1199083492 X:143604100-143604122 CAAAATGGTGAGGAGGAGCCTGG - Intergenic
1199191509 X:144977229-144977251 CAAAATGAAGAGACTGAGCAAGG + Intergenic
1199862173 X:151810968-151810990 AAACATGAGGAGAAAGAGCCTGG + Intergenic
1199870249 X:151892003-151892025 CTAAGTGATGAGAAAGAGCCAGG - Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200524758 Y:4259380-4259402 AAAAATGAGAAAAATGGGCCGGG + Intergenic
1201518679 Y:14847769-14847791 AAAAATGAGAAAAATTAGCCAGG + Intergenic