ID: 1183218364

View in Genome Browser
Species Human (GRCh38)
Location 22:36495922-36495944
Sequence GGTCTGAGGAGCCCACAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183218361_1183218364 -8 Left 1183218361 22:36495907-36495929 CCTTGCAGACGGTGAGGTCTGAG 0: 1
1: 0
2: 2
3: 13
4: 141
Right 1183218364 22:36495922-36495944 GGTCTGAGGAGCCCACAGGTTGG 0: 1
1: 0
2: 2
3: 38
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183218364 Original CRISPR GGTCTGAGGAGCCCACAGGT TGG Intronic
900131577 1:1089507-1089529 GGGTTGGGGAGCCCACAGGAAGG - Intronic
900134834 1:1112004-1112026 GGTGTGCTGAGCCCACGGGTAGG - Intronic
900194788 1:1370755-1370777 CGTCTGAGAAGCACGCAGGTTGG - Intergenic
900571644 1:3361590-3361612 GATCCGAGGAGCTCACAGTTGGG - Intronic
901020322 1:6252041-6252063 GGGCTGAGGAGGCCACTGGCCGG - Intronic
901290589 1:8121160-8121182 GGCCTGAGGAGCCCACGGGCTGG - Intergenic
902199917 1:14825742-14825764 GGTATGAAGAACACACAGGTGGG - Intronic
903641661 1:24864157-24864179 GTTCTGAGGAGAACAGAGGTGGG - Intergenic
903892372 1:26578255-26578277 GGTCTGAGGACCCCAAAGGAAGG - Intergenic
904266903 1:29323503-29323525 GGTCTGAGGAGCCCCAGGGAAGG + Intronic
905788150 1:40774347-40774369 GGTCTGCGGAGGCCACAAGGGGG + Intergenic
906148636 1:43575071-43575093 GGAGTGAGGAGCCCACAGATGGG - Intronic
911589954 1:99735799-99735821 GTAATGAGTAGCCCACAGGTAGG - Intronic
912433630 1:109643435-109643457 GGCCTGAGGATCCCGCAGGCAGG + Intergenic
914923139 1:151860832-151860854 TGTCTGGGGAGCACAGAGGTAGG - Intergenic
916851624 1:168710389-168710411 GGTCTGTGGAGCCAAAAGGTGGG - Intronic
922788172 1:228293945-228293967 GATGTGAGGAGGCCACAGGAGGG + Intronic
922789742 1:228304921-228304943 GGTGTGAGGAGGCCACAGAGGGG + Intronic
923211713 1:231809281-231809303 GGCCAGAGGAGCCCACTTGTTGG - Intronic
924443518 1:244106376-244106398 GGACTGAGAATGCCACAGGTGGG - Intergenic
924738800 1:246782497-246782519 GGCCTGAGGAGGAAACAGGTCGG + Intergenic
1065023894 10:21523678-21523700 TGGCTGAGCAGCCCATAGGTAGG - Exonic
1067944497 10:50681683-50681705 GGCCTGAGGAGCCCACATGGGGG + Intergenic
1068680273 10:59811696-59811718 GCCCTGAGGAACCCACAGATAGG + Intronic
1069547008 10:69335773-69335795 AGACTGAGGTGCCCACAGGATGG + Intronic
1070865996 10:79708554-79708576 GGCCTGAGGAGCCCACATGGGGG + Intronic
1070879790 10:79846685-79846707 GGCCTGAGGAGCCCACATGGGGG + Intronic
1070933992 10:80279402-80279424 GATCAGAGAAACCCACAGGTGGG + Intronic
1071632897 10:87230775-87230797 GGCCTGAGGAGCCCACATGGGGG + Intronic
1071646346 10:87362993-87363015 GGCCTGAGGAGCCCACATGGGGG + Intronic
1075657219 10:124169903-124169925 GGGCTGAGGGTACCACAGGTGGG - Intergenic
1075707481 10:124510332-124510354 GGTATGCGGAGCCCACAAGCTGG + Intronic
1076138882 10:128064174-128064196 GGTGGCAGGAGCCCACAGGAAGG + Intronic
1076567916 10:131411654-131411676 GGTCTGAGCAGCCCACTGCATGG + Intergenic
1076825028 10:132962630-132962652 GGGCAGGGGAGCCCCCAGGTGGG - Intergenic
1077578591 11:3402778-3402800 GGGGTGAGGAGAACACAGGTTGG - Intergenic
1079349220 11:19678596-19678618 CGTCTGAGGAGCCCGCAGATGGG + Intronic
1080931690 11:36817947-36817969 GGTCAGAGAGGCCCACAGGCAGG + Intergenic
1082260400 11:50073233-50073255 GGTCTGTGAAGGCCACAGGGAGG + Intergenic
1083961627 11:66017816-66017838 GTTCTGAGGGGCCCAGAGGAGGG + Intronic
1084433042 11:69122127-69122149 GCTCTGAGGGGCTCACAGGCGGG + Intergenic
1085013311 11:73156458-73156480 GCCTTGAGGAGCCCACAGCTTGG + Intergenic
1088918414 11:114244272-114244294 GGCCTGAGGAGCCAGCAGGATGG + Intronic
1089549859 11:119265527-119265549 GGTGTGAGGAGCCCAGGAGTTGG + Intronic
1089635406 11:119808551-119808573 GGTCTCAGGAGCCGGCAGGCGGG + Intergenic
1091701342 12:2665372-2665394 TGTGTGATGAACCCACAGGTGGG - Intronic
1092275214 12:7055686-7055708 GCACTGAAGAGCCCACAGCTTGG + Intronic
1093353615 12:18135080-18135102 GGTCTGAGGAGACAACAGGTTGG + Intronic
1096103225 12:48981790-48981812 GGTTTGAGGAGTCCCCAGGTAGG - Intergenic
1097242020 12:57581975-57581997 GCCCTGAGGACCCCAAAGGTGGG - Intronic
1100548796 12:95627735-95627757 GGTCTAAGGGGCCCAAAGGCAGG - Intergenic
1102602168 12:114039630-114039652 GCTCTGAGGAGCACTCAGGATGG - Intergenic
1102643473 12:114387484-114387506 GGTCAGTGGTGGCCACAGGTTGG + Intronic
1103976531 12:124706214-124706236 GGTCTGAGGAGCCCTGAGGTGGG - Intergenic
1105212004 13:18262393-18262415 TGTCTGAGGAGGGCACAGGAGGG + Intergenic
1111920179 13:94402119-94402141 GCTCTCAGGAGAACACAGGTGGG + Intronic
1112756974 13:102646759-102646781 GGTCAGAGTAGCTCCCAGGTGGG + Intronic
1114455958 14:22853612-22853634 TGTCTGAGGCGCCCACAGGGGGG - Intergenic
1119036005 14:71231125-71231147 GGGCTGAGCTGCCCACTGGTGGG + Intergenic
1119856449 14:77904683-77904705 GGCAGGAGGAGCCCACAGGAGGG + Intronic
1121121115 14:91376507-91376529 TCTCTGGAGAGCCCACAGGTGGG + Intronic
1121280181 14:92692311-92692333 GTGCTGAGGAGTCCACAGCTGGG + Intergenic
1121333683 14:93063764-93063786 GGACTGAGGCTCACACAGGTGGG - Intronic
1121859758 14:97306257-97306279 TGTCTGAGAAGCACACAGGCTGG + Intergenic
1122138353 14:99647314-99647336 GTCCTGAGGAGCCCCCAGGCTGG - Intronic
1122405758 14:101499937-101499959 GGTCTGTGGAGCCCACATCATGG - Intergenic
1124225274 15:27888038-27888060 GTTCTGAGGCCCCCACAGGAAGG + Intronic
1124538190 15:30562240-30562262 GGTGTGTAGAGCCCTCAGGTGGG + Exonic
1127873010 15:63088876-63088898 GGTCAAAGGAGCCCAGAGGCAGG + Intergenic
1129708325 15:77807196-77807218 GGTATGAGGAGCCCAGAGCAGGG - Intronic
1129719056 15:77867954-77867976 GGTATCAGGAGCCTGCAGGTGGG + Intergenic
1132813868 16:1816844-1816866 GCCCTGAGCAGCCCACAGGAAGG + Intronic
1132826905 16:1909689-1909711 GGGCTGTGGAGACCACAGCTAGG + Intergenic
1132984621 16:2758280-2758302 GGTCTTTTGAGCCCACAAGTTGG + Intronic
1133347199 16:5078927-5078949 GGGGTGAGGAGAACACAGGTTGG - Intronic
1134102722 16:11463236-11463258 GGGGTGGGGAGCCTACAGGTTGG - Intronic
1135679414 16:24443794-24443816 GGTCTGTAGAGCTCCCAGGTTGG + Intergenic
1136847600 16:33589062-33589084 GGGCTGAGGTGCCCACAGAGGGG - Intergenic
1138291913 16:55855095-55855117 GCTCTGTGGTGCCCACAGGAGGG - Intronic
1141253501 16:82380209-82380231 GGGCAGAAGAGCCCAAAGGTAGG + Intergenic
1142207403 16:88790679-88790701 GGTCTGCAGAGCCCCCAGCTCGG - Intergenic
1203109308 16_KI270728v1_random:1437717-1437739 GGGCTGAGGTGCCCACAGAGGGG - Intergenic
1143152467 17:4816037-4816059 AGTCTGAGGAACCCTGAGGTTGG - Intronic
1143247980 17:5501732-5501754 GGCCTGAGTAGACCGCAGGTGGG - Intronic
1143493673 17:7298269-7298291 GATGTGAGGAGACCAGAGGTGGG + Intergenic
1146274618 17:31508825-31508847 CGTCAGAGGAGCCCACAGAGAGG - Intronic
1146912960 17:36659846-36659868 GGTCTGAGGGTCCCAGAGGAGGG + Intergenic
1147168891 17:38606756-38606778 AGTCTGCGGAGCCAACAGGTAGG - Intergenic
1147605176 17:41770341-41770363 GGTCTGGGAGTCCCACAGGTAGG + Intronic
1147844023 17:43392436-43392458 GGTCTCCGGAGCCCACAGGGAGG + Intergenic
1148020267 17:44548614-44548636 GCTCTGAGCAGCCCACACCTTGG + Intergenic
1150421454 17:65039641-65039663 GGTCTGAGGAGGCAACATTTAGG - Intronic
1154503059 18:15005944-15005966 GGGCTGAGGGGCACGCAGGTGGG + Intergenic
1155680822 18:28483538-28483560 GATCTAAGGGGCCCACAGGCAGG - Intergenic
1156508105 18:37611727-37611749 GGCCTGAGGAGCCCATGGGCTGG - Intergenic
1157404773 18:47413691-47413713 GGGCTGAGGAGACCTCAGGCAGG - Intergenic
1157452909 18:47801453-47801475 GGTGTCATGAGGCCACAGGTTGG + Intergenic
1158666545 18:59438036-59438058 GCTCTGATGAGCCTATAGGTTGG - Intronic
1159117624 18:64133526-64133548 GCTGTGAGGAGGCCACAGATAGG + Intergenic
1160182864 18:76650898-76650920 GGTCCCTGGTGCCCACAGGTTGG + Intergenic
1160251044 18:77203695-77203717 GGCCTGCGGAGCCGACAGGCCGG - Intergenic
1160565441 18:79784118-79784140 GGTCTGAGGACGCCACAGTTTGG - Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161501673 19:4619654-4619676 GGAGTGTGGAGCCCAGAGGTTGG - Intergenic
1161551665 19:4916427-4916449 GGTCTCAGGAGGGCACAGGGAGG - Intronic
1162480263 19:10923467-10923489 GGTCTGGGGTGGCCACAGGTGGG - Intronic
1163158085 19:15449761-15449783 GGCCTGGGGAGCCCGCGGGTGGG - Intronic
1163287518 19:16357793-16357815 GGTCTGATGAGTCTCCAGGTCGG + Intronic
1163447883 19:17358147-17358169 GCCCTGAGCAGCCCACAGGGAGG - Intronic
1163710933 19:18846360-18846382 GGTCTGAGGAGGCCAAAGGAAGG - Intronic
1163738603 19:18996969-18996991 GGTCTGAGCAGGGGACAGGTGGG + Intronic
1164925162 19:32124575-32124597 GGTCAGGGGAGGCCACAGGGCGG + Intergenic
1165828474 19:38718978-38719000 GGTGGGAGGAGCTCACAGGTGGG - Intronic
1166339320 19:42128142-42128164 CTCCTGAGGAGCCCACAGTTGGG - Intronic
1167315107 19:48758145-48758167 GGTCCGAGGAGCCCACATCGGGG - Exonic
1167842311 19:52131972-52131994 GGAGTGAGGAGGACACAGGTAGG + Intronic
925215952 2:2095992-2096014 GGTCTGTGGCGCCCACCTGTGGG + Intronic
925977172 2:9149611-9149633 GGTGTGGGGAGCCCACTGATGGG - Intergenic
926166346 2:10523904-10523926 GGTCTCAGGAGCCGAGAGGCCGG - Intergenic
926219491 2:10925432-10925454 GATTTGAGGAGCTCCCAGGTGGG + Intergenic
931164366 2:59730596-59730618 GGTCGCAGGAGCACACAGGTAGG - Intergenic
932585573 2:73025966-73025988 GCTCTGAGGACACCACAGGCAGG + Intronic
932593270 2:73079748-73079770 GGGCAGGGGAGCCCCCAGGTGGG + Intronic
932718348 2:74120097-74120119 TCTCTTAAGAGCCCACAGGTTGG + Intergenic
932983450 2:76698245-76698267 GTGCACAGGAGCCCACAGGTAGG + Intergenic
934301622 2:91780015-91780037 TGTCTGAGGAGGGCACAGGAGGG - Intergenic
934615195 2:95766211-95766233 AGCCTTAGGAGCCCACATGTGGG + Intergenic
937359386 2:121218517-121218539 GTCCTGAGGAGCCCTGAGGTGGG - Exonic
938502224 2:131836114-131836136 GGGCTGAGGGGCACGCAGGTGGG + Intergenic
942184701 2:173413888-173413910 GTTCTGAGGAGCCCTCATGGCGG - Intergenic
943033907 2:182716579-182716601 GGTCTTAAGAGCGCACAGGAAGG - Intronic
943129635 2:183839703-183839725 GGTGTGCAGAGTCCACAGGTGGG + Intergenic
946226936 2:218269244-218269266 CGCTGGAGGAGCCCACAGGTGGG - Intronic
947032939 2:225818832-225818854 GTTCTGAGAAGCTCACGGGTAGG + Intergenic
948288008 2:236802252-236802274 GGTCTCAGGAGCCGACACCTTGG - Intergenic
1169432601 20:5552210-5552232 GGTCTGAGGAGGGGAAAGGTGGG - Intronic
1171879727 20:30609844-30609866 TGTCTTAGGAGACCACAGGTGGG - Intergenic
1172133772 20:32673627-32673649 GGGCAGAGGAGCCTGCAGGTGGG - Intergenic
1179405223 21:41120400-41120422 GGACTGAGGTCCCCACAGGAAGG + Intergenic
1179413607 21:41180474-41180496 GATCTAAGGAGCCCAGAGGCAGG + Intronic
1180119517 21:45737497-45737519 GGTCTGAAGAGCCTACAGTTAGG - Intronic
1180210265 21:46291597-46291619 GGTGTGAGGAGCACCCAGGCTGG + Intronic
1181585479 22:23850625-23850647 TGTCTGGGGAGCCCACACATGGG + Intergenic
1182088113 22:27575354-27575376 GGCCAGATGAGCCCACAGCTTGG - Intergenic
1183218364 22:36495922-36495944 GGTCTGAGGAGCCCACAGGTTGG + Intronic
1184647918 22:45906177-45906199 GGTGTGGGGAGCTCACAGGCTGG - Intergenic
1184786366 22:46673914-46673936 GGCCAGAGGAGCCCTCAGGATGG + Intronic
1185062117 22:48612532-48612554 GGTCGGAAGAGCCCACTGGATGG - Intronic
1185121709 22:48975275-48975297 GGTCTGAGGAGCCCCCCGGGTGG + Intergenic
950882670 3:16335872-16335894 GGTCTCAGGAGGCCACAGGCAGG + Intronic
952219741 3:31313207-31313229 GGTATGAGGAGCCCAAGAGTCGG + Intergenic
953788840 3:45931034-45931056 TGTGTAAGGAGCCCACAGGCAGG + Intronic
954263340 3:49455634-49455656 GGTCTGAGAAGGCCACATGGAGG - Intergenic
955070425 3:55568242-55568264 GGCACGAGGAGCCCACGGGTTGG + Intronic
957051598 3:75416091-75416113 GGGGTGAGGAGAACACAGGTTGG - Intergenic
957416998 3:79917812-79917834 GGTCAGAGGAACCCAGAGGTAGG + Intergenic
961302879 3:125933504-125933526 GGGGTGAGGAGAACACAGGTTGG + Intronic
961887801 3:130107789-130107811 GCTCTGAGGTGGCCACAGGCTGG + Intronic
962629396 3:137260455-137260477 GGTCTGAGCTGGGCACAGGTAGG + Intergenic
963307524 3:143669701-143669723 GGTCTGATCAGAACACAGGTTGG - Intronic
966355560 3:179074763-179074785 GGGCTGATGAGCCTACAGGTCGG + Intergenic
966585445 3:181618967-181618989 GGTGTGAGGAGACATCAGGTTGG - Intergenic
968734003 4:2285859-2285881 GGTCTGTGGTCCCCACAGGCAGG + Intronic
968994381 4:3936470-3936492 GGTGTGAGGACAACACAGGTTGG - Intergenic
969028366 4:4192247-4192269 TGACTGAGGCACCCACAGGTGGG - Intronic
971359446 4:25923223-25923245 GGTCTGAAGAGGCCACAGTTAGG + Intronic
974894856 4:67926752-67926774 GGGCTGAGTTGCCCACTGGTGGG + Intronic
979292586 4:118994132-118994154 GGTCTTAGGAGGCCACACGTTGG - Intronic
986339465 5:6776766-6776788 GGTGGGAGGTGCCCACAGGCAGG + Intergenic
991417989 5:66411250-66411272 GGTCTCTGGATCACACAGGTGGG + Intergenic
996707568 5:126512901-126512923 GGTTTGAGGAGCTTCCAGGTTGG - Intergenic
997468667 5:134104525-134104547 GGCCTGAGGGGCCCCCAGGGTGG - Intergenic
997515903 5:134489831-134489853 GGTCTGAGGGGCCCAAGGCTGGG - Intergenic
998218511 5:140255898-140255920 GGTCTGAGGAGCAGATAGGAGGG - Intronic
999145462 5:149390299-149390321 GATCTAAGGAGGCAACAGGTGGG + Intronic
999298498 5:150475630-150475652 GGACTGAAGATCCCACAGCTTGG + Intergenic
1003392760 6:5727688-5727710 GGTCTGAGGAGTTCACAGATTGG + Intronic
1005146871 6:22701585-22701607 AGTATGAGGAGCCTAGAGGTTGG + Intergenic
1006677630 6:35775892-35775914 GGTGTGAGCAGCCCAGAGGGTGG + Intergenic
1008501548 6:52188415-52188437 GTTCTGTGGAGCCTACAGATTGG + Intronic
1011620471 6:89237702-89237724 GGTGTGCAGATCCCACAGGTGGG - Intergenic
1015759049 6:136637808-136637830 GGGCTGATGATCCCACAGGCAGG + Intronic
1022671035 7:32456448-32456470 GGTTTCAGGAGACAACAGGTAGG - Intergenic
1024548072 7:50538935-50538957 GGGCTGAAGAGCCCACAGATGGG - Intronic
1024565004 7:50673613-50673635 GGTCTCAGGAGCCCCCGGATGGG - Intronic
1024643996 7:51356261-51356283 GGGGTGAGGAGCCCACAGAGGGG - Intergenic
1024973416 7:55091460-55091482 GGTGTGGGGAGGCCACAGTTGGG + Intronic
1025690058 7:63749554-63749576 GGCCTGAAGAGGCCACTGGTAGG - Intergenic
1025690500 7:63751377-63751399 GGCCTGAGGAGGCCACTGGCAGG - Intergenic
1025690948 7:63753200-63753222 GGCCTGAGGAGGCCACTGGCAGG - Intergenic
1025691824 7:63756799-63756821 GGCCTGAGGAGGCCACTGGCAGG - Intergenic
1025692272 7:63758622-63758644 GGCCTGAGGAGGCCACTGGCAGG - Intergenic
1025693134 7:63762124-63762146 GGCCTGAGGAGGCCACTGGCAGG - Intergenic
1025693579 7:63763947-63763969 GGCCTGAGGAGGCCACTGGCAGG - Intergenic
1028233591 7:88333472-88333494 GCTTTGACGAGCTCACAGGTTGG + Intergenic
1029170706 7:98627485-98627507 GGTCTGAGGGGCCAACAGCTGGG - Intronic
1029609940 7:101621493-101621515 GGTAAAAGGAGCTCACAGGTAGG + Intronic
1032228444 7:130052800-130052822 AGAGTTAGGAGCCCACAGGTAGG - Intergenic
1033360800 7:140637763-140637785 GGTCTGAGAAGGGGACAGGTAGG - Intronic
1033411213 7:141119397-141119419 GGCCTGAGGAGCCCTCAGGATGG + Intronic
1034820566 7:154212829-154212851 ATGCTGAGGAGCACACAGGTGGG + Intronic
1035270782 7:157718846-157718868 GGTCTGAGGGCCCCAGAGGTCGG - Intronic
1035271077 7:157720344-157720366 GGTCTGAGGGCCCCAGAGGTCGG - Intronic
1035932874 8:3803541-3803563 GTACGCAGGAGCCCACAGGTGGG + Intronic
1039595506 8:38787296-38787318 GGCCTGAGGAGGCCACAGGACGG + Exonic
1039603984 8:38865999-38866021 GGCCTCAGGAGCTGACAGGTAGG + Intergenic
1049289016 8:141791775-141791797 TTTCTGAAGAGCCCACAGGTGGG + Intergenic
1049510830 8:143025884-143025906 GGCCTGGGCAGCACACAGGTAGG + Intergenic
1049944282 9:579544-579566 GGGCTGAGGAGCTGACAGGCGGG - Intronic
1050581434 9:7061612-7061634 GCTCTGAGGAGCCCACAGCCAGG - Intronic
1055575445 9:77656562-77656584 GGTCAGGGGAGCCCACACCTGGG - Intergenic
1056381006 9:86057490-86057512 GCTCGGGTGAGCCCACAGGTGGG - Intronic
1057354481 9:94322452-94322474 AGGCTGAGGAGCCCACATGGGGG - Intronic
1057484195 9:95469356-95469378 AGTCTGAGGAGGCCACATGGAGG + Intronic
1057653280 9:96935183-96935205 AGGCTGAGGAGCCCACATGGGGG + Intronic
1057857261 9:98611148-98611170 GGGCTGAGGAGCCCATTGTTGGG - Intronic
1058024379 9:100124982-100125004 GGCCTGAGCAGCCCAGAGGTGGG - Intronic
1058231383 9:102430650-102430672 TGTGTTAGTAGCCCACAGGTAGG + Intergenic
1058587613 9:106527509-106527531 TGTCTGAGGTGAGCACAGGTTGG - Intergenic
1058696802 9:107565697-107565719 GGGCTGTGGAGCTCACAGGAAGG + Intergenic
1061158970 9:128882402-128882424 GCACTGGGGAGCCCAGAGGTAGG - Intronic
1061191473 9:129085127-129085149 GGCCTGAGGTTCCCCCAGGTTGG + Intronic
1062039320 9:134396836-134396858 GGTCTGAGCAGGCCACAGGCTGG - Intronic
1062115138 9:134804668-134804690 GGACTCAGCAGCCCACACGTGGG - Intronic
1062208579 9:135350751-135350773 GGTCTCAGGAGCCCAAATGGAGG + Intergenic
1062497217 9:136837565-136837587 GGGCTGAGGGGCACGCAGGTGGG - Exonic
1189462369 X:41253108-41253130 GGTCTGAAGAGCCCCCAATTTGG - Intergenic
1189629342 X:42934781-42934803 GGGCTGAGGGGACCACAGCTGGG + Intergenic
1189821474 X:44873345-44873367 GGGCTGCGGAGCCCCCGGGTCGG - Intronic
1194396211 X:93389539-93389561 AGTCTGAGGAGAAGACAGGTGGG + Intergenic
1199564770 X:149204024-149204046 GGTGTTAGGAGCACAGAGGTTGG + Intergenic
1200115862 X:153769459-153769481 GGGATGAGGAGTCCACAGGCCGG - Intronic