ID: 1183218607

View in Genome Browser
Species Human (GRCh38)
Location 22:36497349-36497371
Sequence AAGAGGGGCAGGGGCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183218596_1183218607 28 Left 1183218596 22:36497298-36497320 CCACTGCACTCCAGCCTGGATGA 0: 4928
1: 92025
2: 179521
3: 208342
4: 192078
Right 1183218607 22:36497349-36497371 AAGAGGGGCAGGGGCATGGAGGG No data
1183218597_1183218607 18 Left 1183218597 22:36497308-36497330 CCAGCCTGGATGACAGAGCGAGA 0: 933
1: 26308
2: 119629
3: 161181
4: 166047
Right 1183218607 22:36497349-36497371 AAGAGGGGCAGGGGCATGGAGGG No data
1183218598_1183218607 14 Left 1183218598 22:36497312-36497334 CCTGGATGACAGAGCGAGACTGT 0: 40
1: 1363
2: 14131
3: 63483
4: 144461
Right 1183218607 22:36497349-36497371 AAGAGGGGCAGGGGCATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183218607 Original CRISPR AAGAGGGGCAGGGGCATGGA GGG Intronic
No off target data available for this crispr