ID: 1183224210

View in Genome Browser
Species Human (GRCh38)
Location 22:36538163-36538185
Sequence GGCCAATGGGCCAGTTGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183224210_1183224216 17 Left 1183224210 22:36538163-36538185 CCACCGCAACTGGCCCATTGGCC No data
Right 1183224216 22:36538203-36538225 CTGTCCCTTCCAGGTAAGACAGG No data
1183224210_1183224215 8 Left 1183224210 22:36538163-36538185 CCACCGCAACTGGCCCATTGGCC No data
Right 1183224215 22:36538194-36538216 TGTACTGTTCTGTCCCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183224210 Original CRISPR GGCCAATGGGCCAGTTGCGG TGG (reversed) Intergenic
No off target data available for this crispr