ID: 1183224477

View in Genome Browser
Species Human (GRCh38)
Location 22:36540095-36540117
Sequence GTGTGGGGTACATCAATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183224472_1183224477 25 Left 1183224472 22:36540047-36540069 CCTTTTCTAAGAGTCATCAGTTT No data
Right 1183224477 22:36540095-36540117 GTGTGGGGTACATCAATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183224477 Original CRISPR GTGTGGGGTACATCAATGCC AGG Intergenic
No off target data available for this crispr