ID: 1183224675

View in Genome Browser
Species Human (GRCh38)
Location 22:36541448-36541470
Sequence GTTATAAAGCACATTGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183224672_1183224675 -9 Left 1183224672 22:36541434-36541456 CCAAAGAATTCCAAGTTATAAAG No data
Right 1183224675 22:36541448-36541470 GTTATAAAGCACATTGAGGCCGG No data
1183224670_1183224675 14 Left 1183224670 22:36541411-36541433 CCACTCGAAAACCTTTCAGGAAT No data
Right 1183224675 22:36541448-36541470 GTTATAAAGCACATTGAGGCCGG No data
1183224671_1183224675 3 Left 1183224671 22:36541422-36541444 CCTTTCAGGAATCCAAAGAATTC No data
Right 1183224675 22:36541448-36541470 GTTATAAAGCACATTGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183224675 Original CRISPR GTTATAAAGCACATTGAGGC CGG Intergenic
No off target data available for this crispr