ID: 1183225780

View in Genome Browser
Species Human (GRCh38)
Location 22:36548996-36549018
Sequence GTGAAGATCAACAGGGACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183225780_1183225792 16 Left 1183225780 22:36548996-36549018 CCCTCGTCCCTGTTGATCTTCAC No data
Right 1183225792 22:36549035-36549057 GGGAAAGGCTTGGGAGATGCCGG No data
1183225780_1183225796 26 Left 1183225780 22:36548996-36549018 CCCTCGTCCCTGTTGATCTTCAC No data
Right 1183225796 22:36549045-36549067 TGGGAGATGCCGGGCTGGGATGG No data
1183225780_1183225797 27 Left 1183225780 22:36548996-36549018 CCCTCGTCCCTGTTGATCTTCAC No data
Right 1183225797 22:36549046-36549068 GGGAGATGCCGGGCTGGGATGGG No data
1183225780_1183225788 -4 Left 1183225780 22:36548996-36549018 CCCTCGTCCCTGTTGATCTTCAC No data
Right 1183225788 22:36549015-36549037 TCACTGTAGAGGGAGAGGCAGGG No data
1183225780_1183225791 7 Left 1183225780 22:36548996-36549018 CCCTCGTCCCTGTTGATCTTCAC No data
Right 1183225791 22:36549026-36549048 GGAGAGGCAGGGAAAGGCTTGGG No data
1183225780_1183225795 22 Left 1183225780 22:36548996-36549018 CCCTCGTCCCTGTTGATCTTCAC No data
Right 1183225795 22:36549041-36549063 GGCTTGGGAGATGCCGGGCTGGG No data
1183225780_1183225790 6 Left 1183225780 22:36548996-36549018 CCCTCGTCCCTGTTGATCTTCAC No data
Right 1183225790 22:36549025-36549047 GGGAGAGGCAGGGAAAGGCTTGG No data
1183225780_1183225786 -9 Left 1183225780 22:36548996-36549018 CCCTCGTCCCTGTTGATCTTCAC No data
Right 1183225786 22:36549010-36549032 GATCTTCACTGTAGAGGGAGAGG No data
1183225780_1183225794 21 Left 1183225780 22:36548996-36549018 CCCTCGTCCCTGTTGATCTTCAC No data
Right 1183225794 22:36549040-36549062 AGGCTTGGGAGATGCCGGGCTGG No data
1183225780_1183225787 -5 Left 1183225780 22:36548996-36549018 CCCTCGTCCCTGTTGATCTTCAC No data
Right 1183225787 22:36549014-36549036 TTCACTGTAGAGGGAGAGGCAGG No data
1183225780_1183225789 1 Left 1183225780 22:36548996-36549018 CCCTCGTCCCTGTTGATCTTCAC No data
Right 1183225789 22:36549020-36549042 GTAGAGGGAGAGGCAGGGAAAGG No data
1183225780_1183225793 17 Left 1183225780 22:36548996-36549018 CCCTCGTCCCTGTTGATCTTCAC No data
Right 1183225793 22:36549036-36549058 GGAAAGGCTTGGGAGATGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183225780 Original CRISPR GTGAAGATCAACAGGGACGA GGG (reversed) Intergenic
No off target data available for this crispr