ID: 1183228741

View in Genome Browser
Species Human (GRCh38)
Location 22:36567760-36567782
Sequence GGACACGGAGCTGGGTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 363}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183228741_1183228749 -5 Left 1183228741 22:36567760-36567782 CCTCAGGACCCAGCTCCGTGTCC 0: 1
1: 0
2: 4
3: 39
4: 363
Right 1183228749 22:36567778-36567800 TGTCCTGGGAGCCATGGGCTAGG No data
1183228741_1183228759 29 Left 1183228741 22:36567760-36567782 CCTCAGGACCCAGCTCCGTGTCC 0: 1
1: 0
2: 4
3: 39
4: 363
Right 1183228759 22:36567812-36567834 GCTGGCTTGAGGCAGGGGTGAGG 0: 1
1: 0
2: 2
3: 78
4: 674
1183228741_1183228751 -1 Left 1183228741 22:36567760-36567782 CCTCAGGACCCAGCTCCGTGTCC 0: 1
1: 0
2: 4
3: 39
4: 363
Right 1183228751 22:36567782-36567804 CTGGGAGCCATGGGCTAGGCAGG 0: 1
1: 0
2: 8
3: 37
4: 404
1183228741_1183228757 23 Left 1183228741 22:36567760-36567782 CCTCAGGACCCAGCTCCGTGTCC 0: 1
1: 0
2: 4
3: 39
4: 363
Right 1183228757 22:36567806-36567828 GGCAGAGCTGGCTTGAGGCAGGG No data
1183228741_1183228760 30 Left 1183228741 22:36567760-36567782 CCTCAGGACCCAGCTCCGTGTCC 0: 1
1: 0
2: 4
3: 39
4: 363
Right 1183228760 22:36567813-36567835 CTGGCTTGAGGCAGGGGTGAGGG 0: 1
1: 0
2: 1
3: 35
4: 536
1183228741_1183228758 24 Left 1183228741 22:36567760-36567782 CCTCAGGACCCAGCTCCGTGTCC 0: 1
1: 0
2: 4
3: 39
4: 363
Right 1183228758 22:36567807-36567829 GCAGAGCTGGCTTGAGGCAGGGG 0: 1
1: 0
2: 6
3: 54
4: 502
1183228741_1183228756 22 Left 1183228741 22:36567760-36567782 CCTCAGGACCCAGCTCCGTGTCC 0: 1
1: 0
2: 4
3: 39
4: 363
Right 1183228756 22:36567805-36567827 AGGCAGAGCTGGCTTGAGGCAGG 0: 1
1: 0
2: 7
3: 57
4: 457
1183228741_1183228755 18 Left 1183228741 22:36567760-36567782 CCTCAGGACCCAGCTCCGTGTCC 0: 1
1: 0
2: 4
3: 39
4: 363
Right 1183228755 22:36567801-36567823 CAGGAGGCAGAGCTGGCTTGAGG 0: 1
1: 0
2: 6
3: 80
4: 704
1183228741_1183228752 2 Left 1183228741 22:36567760-36567782 CCTCAGGACCCAGCTCCGTGTCC 0: 1
1: 0
2: 4
3: 39
4: 363
Right 1183228752 22:36567785-36567807 GGAGCCATGGGCTAGGCAGGAGG 0: 1
1: 0
2: 2
3: 48
4: 372
1183228741_1183228747 -10 Left 1183228741 22:36567760-36567782 CCTCAGGACCCAGCTCCGTGTCC 0: 1
1: 0
2: 4
3: 39
4: 363
Right 1183228747 22:36567773-36567795 CTCCGTGTCCTGGGAGCCATGGG 0: 1
1: 0
2: 1
3: 23
4: 158
1183228741_1183228754 11 Left 1183228741 22:36567760-36567782 CCTCAGGACCCAGCTCCGTGTCC 0: 1
1: 0
2: 4
3: 39
4: 363
Right 1183228754 22:36567794-36567816 GGCTAGGCAGGAGGCAGAGCTGG 0: 1
1: 0
2: 7
3: 133
4: 2113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183228741 Original CRISPR GGACACGGAGCTGGGTCCTG AGG (reversed) Intronic
900160102 1:1219347-1219369 GGGCTCTGAGCTGTGTCCTGGGG - Intronic
900287414 1:1908394-1908416 GGGCACCGAGCTGGGACCTCTGG + Intergenic
900345737 1:2209527-2209549 GGCCAGGGGGCTGGGCCCTGAGG - Intronic
900361009 1:2289113-2289135 GGAGGGGCAGCTGGGTCCTGAGG - Intronic
900522492 1:3112519-3112541 GGCCACTGAGCGGGGCCCTGGGG - Intronic
901066563 1:6497274-6497296 GGACGCGGGGCGGGGTCCTGGGG - Intronic
901144533 1:7056135-7056157 GGACACAGAGCTGGTCCCCGGGG + Intronic
901607265 1:10469013-10469035 AGACATGGTGCTGAGTCCTGGGG - Intronic
902880849 1:19370866-19370888 GGAATGAGAGCTGGGTCCTGCGG - Intronic
903377103 1:22873690-22873712 GGACATGAAGCTGTGTGCTGAGG - Intronic
904470984 1:30736064-30736086 GGGGACGGAGCTGTGTGCTGGGG + Intronic
905445364 1:38025234-38025256 GAACAGGGAGCGGGGTTCTGGGG + Intergenic
906520497 1:46464299-46464321 TGACAAGGAGCTGGGTTTTGGGG + Intergenic
906802380 1:48749338-48749360 GGACATTGCGCTGGGTGCTGGGG - Intronic
912018485 1:105072513-105072535 GGCCACTGAGCAGAGTCCTGAGG - Intergenic
912385619 1:109269865-109269887 GGGCACGGGGCTGGGTGCTCAGG + Intronic
912480190 1:109977302-109977324 GGATCCTGAGCTGGGTCCCGTGG - Intergenic
913239941 1:116821301-116821323 GGACATGGACCTGGGGACTGGGG - Intergenic
915008643 1:152664205-152664227 GAACATGGAGCTGGGCACTGTGG - Exonic
915011084 1:152686943-152686965 GAACATGGAGCTGGGCACTGGGG - Exonic
915321716 1:155060199-155060221 GGTCAGGGAGCTGGTTGCTGTGG - Exonic
916074145 1:161190772-161190794 GGACAAGGACTAGGGTCCTGGGG - Exonic
916743908 1:167669784-167669806 GGACATGGTGCTGGGCCCTCTGG - Intronic
917657255 1:177138586-177138608 GGACAAATAGCTGTGTCCTGAGG + Intronic
919730894 1:200913075-200913097 GGACACGCAGCTGGGTCTGCTGG - Intronic
919984012 1:202660118-202660140 GGACAAGGGGCTGGGTTCTGAGG + Intronic
920034914 1:203059478-203059500 GGACAGTGACCTGGGTCCTCTGG + Intronic
920853093 1:209642062-209642084 GGACAAGGAGCTGGAGACTGCGG + Intronic
921925531 1:220707355-220707377 GGACAGGGAGCTGGGTTGGGGGG + Intergenic
922759209 1:228115424-228115446 GGACACTGAGCAGAATCCTGTGG - Intergenic
923126329 1:231037804-231037826 GGACAGGGAGCAGGGTGGTGTGG - Intronic
923367859 1:233280690-233280712 GGATACCAAGCTGGGTGCTGAGG - Intronic
923522973 1:234750386-234750408 GGAGAAGGAGCTGTGTCTTGAGG - Intergenic
924926815 1:248691825-248691847 GGACCGGCAGCTGCGTCCTGAGG - Intergenic
1063156437 10:3383457-3383479 GGACATGGAGATGGGTCTCGGGG + Intergenic
1066370354 10:34814655-34814677 GGACACCCAGCCGGGTCCCGCGG - Intronic
1066438508 10:35415504-35415526 GGAGATGGAGCTGGGTCCTGAGG + Intronic
1066554001 10:36591125-36591147 GGAGAAGGTGCTGGGTCTTGTGG + Intergenic
1067467358 10:46510968-46510990 GGGCACTGAACTGGGTGCTGGGG + Intergenic
1067473129 10:46550199-46550221 GGAAAGGGACCTGGCTCCTGAGG - Exonic
1067619828 10:47873637-47873659 GGGCACTGAACTGGGTGCTGGGG - Intergenic
1068785534 10:60968472-60968494 AGACACAGAGCTGGGTGCTAGGG + Intronic
1069457103 10:68561561-68561583 GTGCGCGGAGCTGGGTGCTGGGG + Intronic
1069544159 10:69317383-69317405 GGACAGGAAGCTGGGGCCTCAGG + Intronic
1071297762 10:84234495-84234517 AGGCAAGGAGCTGGGTCCAGAGG - Intronic
1071923136 10:90374196-90374218 AGGCACTGAGCTGGGTTCTGTGG - Intergenic
1072336669 10:94403510-94403532 CGCCGCGGAGCAGGGTCCTGCGG + Exonic
1072654362 10:97319854-97319876 GGACAGCGCGCTGGGGCCTGTGG - Exonic
1073191109 10:101651190-101651212 GCTCACAGAGCTGGGGCCTGGGG - Intronic
1073320818 10:102615435-102615457 GGAGGCTGAGCTGGGTGCTGTGG - Intronic
1074288009 10:112116483-112116505 AGCCACTGCGCTGGGTCCTGAGG + Intergenic
1075094282 10:119460852-119460874 AGAGACAGAGCTGGGCCCTGCGG - Intergenic
1075959837 10:126558840-126558862 GGGCACTGAGCTGGGCCCTGGGG - Intronic
1076230530 10:128816822-128816844 AGAGAGGGAGCTGGGGCCTGTGG + Intergenic
1076379394 10:130014825-130014847 GGCCACGAAGCTGGGAGCTGGGG + Intergenic
1076700742 10:132271410-132271432 GGACAAGGAGCTGGGGGCTCTGG - Intronic
1076908847 10:133377596-133377618 GGGCAGTGAGCTGGGCCCTGCGG + Intergenic
1076993769 11:288890-288912 GGACCCCGAGCTGCGTCCCGGGG - Intergenic
1077235311 11:1479304-1479326 AGGCATGGAGATGGGTCCTGAGG - Intronic
1077311235 11:1889915-1889937 GGACCAGGGGCTGGGCCCTGGGG + Exonic
1077409537 11:2397074-2397096 GGAGACGGGCCTGGGTCTTGGGG + Exonic
1077445456 11:2588576-2588598 GGACAGGGACCTGAGGCCTGGGG - Intronic
1077923153 11:6655982-6656004 GGATCCGGAGCCGGGGCCTGGGG - Intergenic
1079299211 11:19262524-19262546 GGGCATGGAGCTGGGCACTGGGG - Intergenic
1079819378 11:25105800-25105822 ACACAGGGAGCTGTGTCCTGAGG + Intergenic
1081065781 11:38537333-38537355 GGTCACGGAGATGGCTCCTGAGG + Intergenic
1082029523 11:47594322-47594344 GGACAGGGTGCTGGGGCCAGGGG + Exonic
1083484625 11:62975533-62975555 GGAGGAGAAGCTGGGTCCTGGGG + Intronic
1083626710 11:64075571-64075593 GGACAAGGATCTGGCTGCTGAGG - Intronic
1083772929 11:64878471-64878493 GGACACGGGGCTGGCTGCTGCGG + Exonic
1084191220 11:67499837-67499859 GGACAGGGGGCTGTGTCATGGGG + Intronic
1084208760 11:67611291-67611313 GGAGACGGGGCTGGGTCTAGGGG + Intronic
1084447631 11:69212941-69212963 AGCCACGGAGCTGGGGGCTGGGG + Intergenic
1085038601 11:73313966-73313988 GAACACAGGGCTGGGTCCTCGGG + Intronic
1085417499 11:76329112-76329134 GGCCCTGGAGCGGGGTCCTGGGG - Intergenic
1088668629 11:112119608-112119630 AGGCACTGTGCTGGGTCCTGGGG + Intronic
1089337596 11:117735732-117735754 GGGCCCGGAGCTGCGTCCAGCGG + Intronic
1089735389 11:120547153-120547175 GGCCACTGAGCTGGCTCCTGAGG - Intronic
1090661462 11:128885127-128885149 GGGCACCAAGCTGAGTCCTGGGG + Intergenic
1091002752 11:131924135-131924157 GGGCACGGAGCTGGGGGCCGTGG + Intronic
1091062290 11:132474782-132474804 GGACACATATCTGGTTCCTGTGG + Intronic
1091192926 11:133709226-133709248 GGGCAGGGAGCTTGGTACTGTGG - Intergenic
1091218403 11:133917387-133917409 GGACACAGTGCTGGTCCCTGGGG + Intronic
1091387766 12:105416-105438 GGACAGGGGGCTTGCTCCTGTGG + Intronic
1091688244 12:2578840-2578862 GGACACAGAGCTGTGTCTGGAGG - Intronic
1092000565 12:5028416-5028438 AGGCACTGAGCTGGGTCTTGGGG + Intergenic
1093771554 12:23023549-23023571 TGCCAAGGAGCTGGGTCCTTAGG + Intergenic
1093774142 12:23052824-23052846 GAACCCAGAGCTAGGTCCTGGGG - Intergenic
1094000666 12:25690544-25690566 GGATAGGGAGCTGCTTCCTGCGG + Intergenic
1094524873 12:31224933-31224955 GCAGAGGGAGCTGGGTGCTGTGG - Intergenic
1095465467 12:42483890-42483912 GGACGCGGAGCTGGGGCTTGGGG - Intronic
1096361502 12:50991891-50991913 GGACACTGTGCTAGGTCCTGTGG - Intronic
1096672614 12:53209250-53209272 GGACACGGAGGAGGGGCTTGAGG + Intergenic
1099614066 12:84912667-84912689 GGACCCGGAGCTGGGTTTTGGGG + Exonic
1100360868 12:93878306-93878328 GGACACTAATCAGGGTCCTGAGG - Intronic
1100632603 12:96403184-96403206 GGCCATGGGGCTGGGTGCTGTGG - Intergenic
1102030373 12:109736863-109736885 GGACACACAGCTGGGGTCTGGGG - Intronic
1102035611 12:109769033-109769055 GGTCACGGAGCTGGGGCCGGGGG + Exonic
1103221880 12:119253084-119253106 GTCCAGGGTGCTGGGTCCTGTGG - Intergenic
1103526449 12:121572355-121572377 GGCCACGGAGCTGGGATGTGAGG - Intronic
1103744658 12:123114345-123114367 GGGCAGGGAACTGGGTGCTGGGG - Intronic
1103942972 12:124510878-124510900 GGTCACGGAGCTGGGCCGTGAGG - Intronic
1106308390 13:28532789-28532811 GGACACGGCGCTGGGCTCCGGGG + Intergenic
1106391558 13:29339488-29339510 GCACAGGGATCTGGGGCCTGGGG + Intronic
1106493121 13:30247114-30247136 GGACACGCAGCTAGATCCTAGGG + Intronic
1107484361 13:40812163-40812185 GGACACTGAGCAGGGGACTGTGG - Intergenic
1107835447 13:44409394-44409416 AGGCACTGAGCTGGATCCTGGGG + Intergenic
1108669136 13:52664874-52664896 GGACACTGTGCTTGGTCCTAGGG + Intronic
1110412482 13:75219850-75219872 GCACCCGGAGCTGGGCTCTGAGG - Intergenic
1113537028 13:111076251-111076273 GAACACTGTGCTGGGGCCTGGGG - Intergenic
1114528843 14:23382629-23382651 GGACAGGGAGCTGGAACCTCAGG - Intronic
1114617623 14:24076628-24076650 GGACAGGAAGCTGGGCCCTGGGG - Intronic
1115306618 14:31940192-31940214 GGACATGGAGCAGGGCCCTGTGG + Intergenic
1116631243 14:47336875-47336897 GGGCACTGTGCTGGGTACTGTGG - Intronic
1119156867 14:72419617-72419639 GGCCACTGAGCTGGACCCTGTGG + Intronic
1121616310 14:95316037-95316059 GAACACTGAGCTGGACCCTGAGG + Intronic
1121622056 14:95357131-95357153 AGACACTGAGCTGGGTACTGGGG + Intergenic
1122138172 14:99646327-99646349 GGACACGGCCCTGGCCCCTGGGG - Intronic
1122900344 14:104779765-104779787 GGTCTCCGAGCTGAGTCCTGAGG - Intronic
1123016175 14:105376773-105376795 GGACTCGGAGCAGGACCCTGCGG + Exonic
1123039214 14:105483541-105483563 GGGCAGGGAGGTGGGCCCTGGGG + Intergenic
1123053795 14:105559998-105560020 GGACACGGAGATGGGTGCTTGGG + Intergenic
1123078378 14:105680415-105680437 GGACACGGAGATGGGTGCTTGGG + Intergenic
1123873234 15:24597311-24597333 GGAAAACGAGGTGGGTCCTGAGG + Intergenic
1123946109 15:25239682-25239704 GGACACTGGCCTGGGGCCTGGGG - Intergenic
1123947376 15:25245323-25245345 GGACACTGGCCTGGGGCCTGTGG - Intergenic
1123948582 15:25250715-25250737 GGACACTGGCCTGGGGCCTGTGG - Intergenic
1124019380 15:25905249-25905271 GGGGAGGGAGCTGGGTGCTGTGG - Intergenic
1125795875 15:42403582-42403604 TGACATGGGGCTGGTTCCTGGGG + Intronic
1126331634 15:47538394-47538416 TGACATGCTGCTGGGTCCTGTGG - Intronic
1126672865 15:51132249-51132271 GGACAAGAAGCTGGGTCTAGAGG - Intergenic
1127988462 15:64093718-64093740 GGACGCTGAGCAGAGTCCTGTGG - Exonic
1128794583 15:70456000-70456022 GGACATGGTGGTGGGCCCTGTGG - Intergenic
1129411790 15:75354459-75354481 GGCCACACAGCTGAGTCCTGAGG + Exonic
1129831988 15:78676611-78676633 GAACACGGTGCTAGGCCCTGCGG + Intronic
1130100755 15:80892142-80892164 TGACACGGAGTTGGGCACTGGGG - Intronic
1131383750 15:91985863-91985885 GTGCACGGAGCTGGTTCCTGTGG + Intronic
1132023171 15:98382394-98382416 GGCTACGGAGCTGGGGCATGGGG - Intergenic
1132666124 16:1082102-1082124 GGACAGGGACCGGGGTCCTGGGG - Intergenic
1132692266 16:1186927-1186949 GGACACAGGGCTGGTTCCCGGGG + Intronic
1132703494 16:1231548-1231570 GCACAGGGAGCTGGGGCCGGGGG - Intergenic
1132708020 16:1254847-1254869 GCACAGGGAGCTGGGGCCGGGGG + Intergenic
1132897342 16:2235308-2235330 GGAGACGGCGCTGGGCCCAGAGG + Exonic
1133027894 16:2996602-2996624 GGACAGAGAGCTGGGGTCTGGGG + Intergenic
1133039032 16:3050135-3050157 TGACATGGAGGTAGGTCCTGGGG + Exonic
1133834234 16:9351865-9351887 GGACACTGGGCAGAGTCCTGAGG - Intergenic
1133834247 16:9351945-9351967 GGACACTGGGCAGAGTCCTGAGG - Intergenic
1134202906 16:12213793-12213815 GGCCACATAGCTGGGTACTGGGG - Intronic
1134903394 16:17958945-17958967 GGACATGGAGCTGGGCACGGTGG + Intergenic
1135268676 16:21050252-21050274 GGACACTGTGCTGGGCTCTGAGG - Intronic
1135542891 16:23345954-23345976 GGACACAGAGCAGGAACCTGCGG - Intronic
1135876079 16:26201236-26201258 AGGCACTGTGCTGGGTCCTGGGG - Intergenic
1136180676 16:28549724-28549746 GGACAGGGAGGTGGGGCATGAGG - Intergenic
1138339162 16:56277321-56277343 GGTCACGGAGCCAGGGCCTGTGG + Intronic
1139283343 16:65788538-65788560 GCACATGGACCTGGGTGCTGAGG - Intergenic
1139592304 16:67940083-67940105 GGCCACAGAGCTCGGTGCTGCGG + Exonic
1140985760 16:80156757-80156779 TGACACTGAGCTGGGCCTTGAGG + Intergenic
1142026978 16:87819666-87819688 GGACACCAAGGTGGGGCCTGTGG + Intergenic
1142081038 16:88148884-88148906 GGACACGCTGCAGGGTCCTCAGG + Intergenic
1142174701 16:88639729-88639751 GTACACGGAGAGGGGCCCTGAGG + Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142560817 17:807850-807872 GGAAACGGAACTGGCTTCTGCGG + Intronic
1142741941 17:1936585-1936607 GGGCACGGATGGGGGTCCTGCGG + Exonic
1142884942 17:2906580-2906602 CAACACTGAGCTGGGTGCTGGGG - Intronic
1143055623 17:4159790-4159812 GGGTACGGAGCTGAGTCATGTGG - Intronic
1143055678 17:4160129-4160151 GGGTACGGAGCTGAGTCATGTGG - Intronic
1143055683 17:4160159-4160181 GGGTACGGAGCTGAGTCATGTGG - Intronic
1143055695 17:4160216-4160238 GGGTACGGAGCTGAGTCATGTGG - Intronic
1143728362 17:8865675-8865697 GGACAGAGCTCTGGGTCCTGAGG + Intronic
1143778634 17:9217236-9217258 AGACAAAGAGCTGTGTCCTGAGG + Intronic
1144564624 17:16349698-16349720 TGACACAGAGCAGGGTCCTCAGG - Intronic
1144595666 17:16568607-16568629 GGGCTCGGAGCTGGAGCCTGGGG - Intronic
1144702801 17:17349862-17349884 GGAGACCGTGCTGGGACCTGAGG - Intergenic
1145010622 17:19365587-19365609 GGACCCGGAGCTGAGCTCTGAGG - Intronic
1147054861 17:37826268-37826290 AGACACTATGCTGGGTCCTGGGG + Intergenic
1147481858 17:40772679-40772701 GGAGGCTGAGCTGGGTGCTGAGG - Intergenic
1148209455 17:45799575-45799597 GGCCAAGGTCCTGGGTCCTGGGG - Intronic
1149693684 17:58599588-58599610 AGACATGGATCTGGGGCCTGAGG + Exonic
1150265488 17:63829965-63829987 GGAGACCGAGCTGGTCCCTGGGG - Intronic
1150816688 17:68397374-68397396 GCACACGGGGCTGGCACCTGTGG + Intronic
1151257710 17:72891942-72891964 GGACACTGTGCTAGGCCCTGAGG - Intronic
1151756074 17:76075994-76076016 GGACACTGGGATGGTTCCTGGGG + Intronic
1151829389 17:76540696-76540718 GGACAGGGAGCAGGGTGCTTAGG - Intronic
1152300884 17:79494931-79494953 GAACAGGGAGCTGGGCCCCGAGG + Intronic
1153917265 18:9757314-9757336 GGACATGGAGCAGGTGCCTGCGG + Intronic
1155253977 18:23978605-23978627 GGAAGGGGAGCTGGGTCCAGTGG + Intergenic
1157339710 18:46768453-46768475 GGACCCGGAGCTGTGCCCTCCGG + Intergenic
1158413975 18:57233025-57233047 GCACAGGAAGCTGTGTCCTGGGG - Intergenic
1160610067 18:80077847-80077869 GGGCACAGAGCTGAGTTCTGAGG + Intronic
1160959506 19:1713053-1713075 GGGCACAGAGCAGGGCCCTGGGG + Intergenic
1161232794 19:3183348-3183370 AGAGACGGGGCTGGGTGCTGTGG + Intergenic
1161317389 19:3623970-3623992 AGACGCGGAGCTGGATGCTGAGG + Exonic
1162389534 19:10380910-10380932 GGACATGCAGCTGTGTCCTAGGG - Intergenic
1163650821 19:18516665-18516687 GGACCCAGAGCTGGCTCCTGGGG - Intronic
1163797018 19:19343635-19343657 GGAGACGGAGCTGGAGCCAGAGG - Intronic
1163799584 19:19356500-19356522 GGAGATGGAGCTGGGAGCTGAGG + Exonic
1164781736 19:30898193-30898215 GAAAACAGAGCTGGGTGCTGTGG - Intergenic
1164948794 19:32318676-32318698 GGTGACTGAGCTGGGGCCTGGGG + Intergenic
1165010218 19:32840594-32840616 GGTCAAGGAGCTGGAGCCTGTGG - Intronic
1165421072 19:35722288-35722310 GGACAGGGAGCTGGGTGTGGTGG - Intronic
1165435654 19:35793315-35793337 GGACACAGAGATGGAACCTGGGG - Intergenic
1165858371 19:38893778-38893800 GGACAGGGAGCAGGGTTCTGGGG - Intronic
1166412640 19:42566474-42566496 GGACAGGGACGGGGGTCCTGGGG + Intergenic
1166898866 19:46042668-46042690 GGACATGGTGCTGGCACCTGTGG - Intronic
1167567696 19:50267207-50267229 GTACAGGGAGCAGGGCCCTGGGG + Intronic
1168635057 19:57989732-57989754 GGACTCGAAGCTGGGTGCAGTGG - Intronic
925274425 2:2638648-2638670 CCACACAGAGCTGGGTCCTGGGG - Intergenic
925973763 2:9126405-9126427 GGAGACGGTGCTGGTTGCTGGGG - Intergenic
925981416 2:9180404-9180426 GGACACAGAGCCAGGCCCTGGGG - Intergenic
926330861 2:11824201-11824223 TGAAAAGGAGCTGGGTCCTGGGG - Intronic
926723701 2:15981720-15981742 GGACACAGAGCATGGTACTGAGG - Intergenic
927515991 2:23671963-23671985 GCTGACAGAGCTGGGTCCTGTGG + Intronic
927846286 2:26474272-26474294 GGGCCTGGAGCTGGGGCCTGGGG - Intronic
927868143 2:26606157-26606179 AGACACTGCGCTGAGTCCTGGGG + Intronic
935184318 2:100717925-100717947 GGACACCCAGCTGGTGCCTGTGG - Intergenic
935430537 2:102971267-102971289 GGACAATGAGTGGGGTCCTGTGG - Intergenic
935579482 2:104744317-104744339 TGACACGGGGCTGAGTCCTGGGG - Intergenic
937305724 2:120869254-120869276 GGTCAGGGGGCTGGGCCCTGGGG + Intronic
937335151 2:121058135-121058157 GTACAGGGTGCTGGGACCTGGGG + Intergenic
937924151 2:127154663-127154685 GGCCAAGGAGCTGAGTCCTGGGG + Intergenic
938322248 2:130373018-130373040 GGGCATGGAGCTTAGTCCTGTGG + Intronic
938861214 2:135371854-135371876 GGACACTGATCTGGTTCATGAGG - Intronic
942202986 2:173590724-173590746 GGACACGGAGCTGGGTCTTTAGG + Intergenic
942247886 2:174024115-174024137 GGCCACGGTGATGGTTCCTGCGG + Intergenic
946012135 2:216573799-216573821 GGACACTGGGCTGGGTGCGGTGG + Intronic
946426435 2:219600384-219600406 GGACACTGAGCTGGTTGCCGTGG - Intronic
946987250 2:225286883-225286905 GGACAAGGAACTGGGTCCCAAGG + Intergenic
947437510 2:230085229-230085251 GGCCACTGAGATGGGGCCTGGGG - Intergenic
947542773 2:230990320-230990342 GGACATGGAGCAGCGGCCTGGGG + Intergenic
947632583 2:231663573-231663595 GGAGAAGCAGCTGGGGCCTGGGG + Intergenic
948383274 2:237566444-237566466 GTGCACGGAGCTGGGACCTTGGG - Intergenic
948403090 2:237698523-237698545 GGACAGTGTGCTGGCTCCTGGGG + Intronic
948603304 2:239119665-239119687 GGACACGGAGATGGGAGCTCAGG + Intronic
948687583 2:239678752-239678774 GGACACAGAGCTGGGCCTTTTGG + Intergenic
948855239 2:240727280-240727302 GGACAGGGAGCTGGGATGTGGGG + Intronic
1169394489 20:5217561-5217583 GGGCTAGGAGCTGGGGCCTGGGG + Intergenic
1169928908 20:10811133-10811155 GAACCCAGAGCTGGGGCCTGTGG + Intergenic
1170604184 20:17863627-17863649 GGACGGGGAGCTGGGCCTTGGGG - Intergenic
1171406380 20:24914862-24914884 GGGCAGGGAGCTGAGGCCTGAGG - Intergenic
1171406393 20:24914903-24914925 GGGCAGGGAGCTGAGGCCTGAGG - Intergenic
1172221088 20:33275682-33275704 GGACACAGAGCTGGGTGCCTTGG - Intronic
1172845741 20:37929137-37929159 GGACTTTGAGCAGGGTCCTGTGG + Intronic
1173870243 20:46337296-46337318 GGACACTGAGCTGGGCGCGGTGG + Intergenic
1173906372 20:46632506-46632528 GGACAGGGAGCTGGGACCTGGGG + Intronic
1174812881 20:53662376-53662398 GCACAAGGAGCTGGGTGCGGTGG - Intergenic
1175225457 20:57441610-57441632 GGAGTGGGAGCGGGGTCCTGGGG - Intergenic
1175290346 20:57871095-57871117 GAACCCGGAGCTGGGATCTGAGG - Intergenic
1175780652 20:61680138-61680160 GGAGGTGGTGCTGGGTCCTGGGG - Intronic
1175979278 20:62728881-62728903 GGACACTGAGAAGGGTCTTGGGG + Intronic
1176312550 21:5160509-5160531 GGCCACGGACCTGGGTACTAGGG + Intergenic
1176430078 21:6570008-6570030 GGACAAGGAGCTGCTTGCTGGGG + Intergenic
1177105134 21:16945966-16945988 GGACACTGGGCAGAGTCCTGAGG + Intergenic
1177535686 21:22423907-22423929 GTACAAGGAGCTGGGTCCTTTGG + Intergenic
1177775741 21:25563773-25563795 GGTTAGGAAGCTGGGTCCTGTGG - Intergenic
1178358043 21:31924620-31924642 GGTCATGGAGCTGTGCCCTGGGG + Exonic
1179705472 21:43177470-43177492 GGACAAGGAGCTGCTTGCTGGGG + Intergenic
1179844498 21:44101521-44101543 GGCCACGGACCTGGGTACTAGGG - Intronic
1180875172 22:19171817-19171839 GGACACGGAGAAGCTTCCTGGGG - Intergenic
1180974899 22:19842894-19842916 GGACAGGGAGCTGGCTGCAGTGG - Intronic
1181006587 22:20016538-20016560 GGACCCGGGGCTGGGGCCTCGGG - Intronic
1181046163 22:20215314-20215336 CTACACGGGGCTGGGGCCTGAGG + Intergenic
1181185855 22:21103126-21103148 CGACTTGGAGCTGTGTCCTGGGG + Intergenic
1181343740 22:22202017-22202039 AGACAAGCAGCTGGGACCTGGGG + Intergenic
1182446467 22:30392597-30392619 GGGCAGGGAGCTGGGACCTCAGG - Intronic
1182679431 22:32067189-32067211 GGAAAGGGAGCAGGGCCCTGAGG - Intronic
1183228741 22:36567760-36567782 GGACACGGAGCTGGGTCCTGAGG - Intronic
1183425521 22:37737137-37737159 GGACACGGTGCTGTGTCCCGGGG + Intronic
1184095268 22:42312921-42312943 GAGGACGAAGCTGGGTCCTGGGG + Intronic
1184152401 22:42646582-42646604 GGGCAGGGAGCTGGCACCTGGGG - Intronic
1184734477 22:46390149-46390171 AGACACAGAGCTGGGTCCTCTGG + Intronic
1184821030 22:46909457-46909479 GGCGACAGAGCTGGGTCCAGTGG + Intronic
1185063203 22:48617793-48617815 GAAGACGGAGCAGGGCCCTGGGG + Intronic
1185069468 22:48648175-48648197 GGACGCGGTGCAGGGACCTGTGG + Intronic
1185287450 22:50008860-50008882 GGTCGGGGAGCTGGGGCCTGAGG - Intronic
950333482 3:12175694-12175716 GGACAGGGAGCTGGGGCTTGGGG + Intronic
952315237 3:32226521-32226543 GGACTCGGGGCTGGGTGGTGGGG + Intergenic
953916704 3:46925094-46925116 GGGCAGGGTGATGGGTCCTGTGG - Intronic
954234364 3:49244886-49244908 GCACACTGAGCTGGGTAGTGAGG + Intronic
954370933 3:50169307-50169329 GCACACGGGGCTGGGTCCTGGGG - Intronic
954379010 3:50209787-50209809 GGCCAGGGAGCTGGGGGCTGAGG + Intronic
954422790 3:50427351-50427373 GGACCCCCAGCTGGCTCCTGTGG + Intronic
954687720 3:52379667-52379689 GGACTCGGAGCTGAGGCATGAGG + Intronic
954710263 3:52501973-52501995 GGGCACAGAGCTGAGTACTGTGG + Intronic
956724515 3:72145987-72146009 GGACACGGAGCTGTCTCCTTGGG - Intergenic
958801034 3:98756124-98756146 GGAGACTGAGCTGGGTCCTTTGG + Intronic
961046008 3:123708539-123708561 GGACAGGGAGCTGGCCTCTGGGG + Intronic
962312946 3:134338766-134338788 GGAGACAGAGCAAGGTCCTGTGG + Intergenic
962824865 3:139091496-139091518 TGACACAGAGCTGGCTCATGTGG + Intronic
965294596 3:166927399-166927421 AGACACTGTGCTAGGTCCTGGGG - Intergenic
965538873 3:169852615-169852637 GGTAACGGCACTGGGTCCTGAGG + Intronic
966470794 3:180286603-180286625 GGACATGTAGCTGGGTCATCAGG + Intergenic
966834119 3:184036333-184036355 GGACAGGGAGGTAGGTGCTGTGG - Intronic
968815176 4:2818243-2818265 GGCCGCGGAGCTGGGGCCGGCGG + Exonic
968930130 4:3574535-3574557 GGACCCGGTGCGGGCTCCTGTGG - Intergenic
972598863 4:40554084-40554106 AGGCACCGTGCTGGGTCCTGGGG - Intronic
974437410 4:61874287-61874309 GGACAAGGAGCTGAGACCAGTGG - Intronic
978107724 4:104924427-104924449 GGACATGGAACTGGGTTTTGTGG - Intergenic
981071504 4:140545334-140545356 GGGCACAGGGCTGGGCCCTGAGG - Intronic
982234297 4:153237997-153238019 GGACTCAGAACTGGCTCCTGAGG - Intronic
983889459 4:173015947-173015969 GGACACGGCACCGTGTCCTGAGG - Intronic
984497352 4:180515470-180515492 GGGCACTGTGCTGGGTACTGAGG + Intergenic
984715198 4:182917966-182917988 GGGCAGGGAACTGGGTCCGGCGG + Intergenic
984789582 4:183603234-183603256 GTACATGGGGCTGGGTGCTGTGG + Intergenic
985520616 5:372505-372527 GGACAGGGAGCTGGGCCCAGGGG - Intronic
985595152 5:784639-784661 GGGCGCGGGGCTCGGTCCTGCGG - Intergenic
987031621 5:13981350-13981372 AGGCACGGTGCTGGGTGCTGGGG - Intergenic
990114825 5:52376782-52376804 GAACACTGTGCTGGATCCTGGGG + Intergenic
990529241 5:56657445-56657467 AGACACTGAGCTGGGTACTAGGG + Intergenic
990982325 5:61613220-61613242 GAACACTGTGCTGGGTGCTGGGG + Intergenic
991532725 5:67633792-67633814 GGGCAAGGAGTTGAGTCCTGAGG + Intergenic
992590836 5:78294510-78294532 GGCGACGGAGCTGGGTCAGGAGG - Exonic
993932245 5:93954440-93954462 GGACACTGGGCAGAGTCCTGAGG - Intronic
995626062 5:114077512-114077534 GGACACTGCCCTGGGTCTTGAGG + Intergenic
999370513 5:151052351-151052373 GGATAAGGAGTTGGGCCCTGGGG - Intronic
999693717 5:154170322-154170344 GGACAAGGAGCAGTGTGCTGAGG + Intronic
1001299702 5:170524782-170524804 GAACACTGGGCTGGGTCCTGGGG - Intronic
1001601049 5:172928637-172928659 GGGTACAGGGCTGGGTCCTGGGG - Intronic
1001633853 5:173196016-173196038 GGACATTGTGCTGGGTGCTGGGG - Intergenic
1001937337 5:175714739-175714761 GCACAAGAGGCTGGGTCCTGGGG - Intergenic
1001991190 5:176116749-176116771 GGACACGGAGCTGGTGGCTAAGG - Intronic
1002095978 5:176831331-176831353 GGACAGGGAGAGGGGCCCTGGGG - Intronic
1002225684 5:177721387-177721409 GGACACGGAGCTGGTGGCTAAGG + Intronic
1002268165 5:178049818-178049840 GGACACGGAGCTGGTGGCTAAGG - Intronic
1002712795 5:181205167-181205189 GGACGCGGAGCTGGGCGCCGAGG + Exonic
1004050485 6:12073473-12073495 GGACACAGAGATGGGGTCTGGGG - Intronic
1004510109 6:16278151-16278173 GGACAAACAGCTGGGCCCTGTGG + Intronic
1006874062 6:37280097-37280119 GGTCAGGAAGCTGGGACCTGGGG - Intronic
1007001694 6:38319610-38319632 GGACACTGGGCAGAGTCCTGAGG - Intronic
1007221870 6:40285197-40285219 GGACACAGTGCTGGGTCCCCAGG + Intergenic
1007614718 6:43173010-43173032 AGACAAGGAGCTGGATCCTTGGG + Intronic
1007664888 6:43508322-43508344 GGACGCGGACCTGGGAGCTGTGG + Exonic
1011151297 6:84276316-84276338 AGACACTGTGCTTGGTCCTGGGG + Intergenic
1012027052 6:94008846-94008868 GGACACTGAGCAGAGTCCTTAGG + Intergenic
1014247746 6:119084923-119084945 GAGCAGGGAGCAGGGTCCTGAGG + Intronic
1015121553 6:129706597-129706619 GGACATGGAGCCGGGTGCAGTGG + Intronic
1017399154 6:154039612-154039634 GGAACCGGGGCTGGGTGCTGGGG - Exonic
1018368221 6:163143994-163144016 GGAGGCCGAGGTGGGTCCTGAGG + Intronic
1018473481 6:164117609-164117631 GGAAACGGAGCAGGTGCCTGAGG - Intergenic
1018937197 6:168281230-168281252 CGAGCCGGAGCTGTGTCCTGGGG + Intergenic
1019085591 6:169473244-169473266 GGACAGAGAGCTGGGTCAAGTGG - Intronic
1019215088 6:170438386-170438408 GCACACAGAGCTGCGTGCTGAGG - Intergenic
1023393528 7:39732413-39732435 GGACACCAAGCTGGGGCCTCAGG + Intergenic
1023680616 7:42683394-42683416 GGACAGTGAGCTGGCTCCTCAGG + Intergenic
1023822206 7:43986547-43986569 GGGCAGGGGGCTGGGGCCTGGGG - Intergenic
1023940044 7:44763365-44763387 GGGCAGGGAGCTGGATCCTGCGG - Exonic
1024568981 7:50708959-50708981 GGACTCACAGCTGGGTACTGTGG - Intronic
1025720117 7:64002166-64002188 GTACAAGGAGCTGGGTGCTGTGG - Intergenic
1029750472 7:102539961-102539983 GGGCAGGGGGCTGGGGCCTGGGG - Intronic
1029768424 7:102639069-102639091 GGGCAGGGGGCTGGGGCCTGGGG - Intronic
1029970122 7:104780434-104780456 GGAGAAGGAGCTGCGTCCTCTGG - Intronic
1032319644 7:130874376-130874398 GGACAAGGAGCAAGGTCATGTGG + Intergenic
1032529570 7:132609055-132609077 GGACACTGAGCTGGGCCTTTAGG - Intronic
1033241392 7:139682623-139682645 GGACATGGTGCAGGGTGCTGTGG - Intronic
1034077872 7:148250046-148250068 GGTCACGGGGCTAGTTCCTGTGG - Intronic
1035375586 7:158404857-158404879 GGCCAGGGAGCTGGGGGCTGGGG - Intronic
1035375620 7:158404944-158404966 GGCCAGGGAGCTGGGAGCTGGGG - Intronic
1036560662 8:9898431-9898453 GGACACGTCTCTGGGTCCTGGGG + Intergenic
1037379948 8:18274610-18274632 GGACACCCTGCTGGATCCTGAGG + Intergenic
1041100918 8:54395956-54395978 GGACTAGGAACTGAGTCCTGAGG + Intergenic
1041351286 8:56950426-56950448 GGACATGAGGCTGGGTGCTGTGG - Intergenic
1043133255 8:76488372-76488394 GGACATGGACCTGGCTACTGAGG - Intergenic
1044716380 8:95103596-95103618 GGTCAGGGAACAGGGTCCTGTGG - Intronic
1045368040 8:101493942-101493964 GGAGCCGGAGGTGGGTCCCGCGG + Intronic
1048351203 8:133618127-133618149 ATACACTGAGCTGGGTGCTGGGG + Intergenic
1048853928 8:138670324-138670346 GTGCACAGAGCTGCGTCCTGTGG - Intronic
1048982998 8:139713177-139713199 GGACAGGGACCTGGGACCTAGGG + Intergenic
1049082900 8:140457167-140457189 GGACGCGCGGCTGGGGCCTGGGG - Intronic
1050587019 9:7123587-7123609 AGACACCGTGCTGGGTTCTGTGG + Intergenic
1053515724 9:38729211-38729233 GGGCACTGTGCTGGGTTCTGAGG + Intergenic
1054459950 9:65457270-65457292 GGACCCGGTGCGGGCTCCTGTGG + Intergenic
1054849792 9:69835937-69835959 TGACACGGAGCTGGGCCCTCTGG + Intronic
1060218157 9:121750861-121750883 GGACACTGTCCTGGCTCCTGGGG - Intronic
1060505944 9:124198613-124198635 GGACAAGGAGGTGGGCCTTGGGG - Intergenic
1060910320 9:127344582-127344604 GGGCCCAGAGCTGGGCCCTGTGG - Intronic
1061505707 9:131030795-131030817 GGACAAGGAGCTGAGGCCTGGGG - Intronic
1061624148 9:131831379-131831401 GGGCTCCGAGCTGGGTCCTCTGG - Intergenic
1061631362 9:131874237-131874259 AGACCCTGAGCTGAGTCCTGAGG - Intronic
1062035894 9:134382387-134382409 GGGCCAGGAGCTGGGTGCTGAGG + Intronic
1062285428 9:135770600-135770622 GGACCCGGAGCCCAGTCCTGCGG - Intronic
1062391440 9:136335531-136335553 AGACACTGAGCTGGGTGCTGAGG - Intronic
1062439624 9:136563897-136563919 GGCCATGGAGCTGGGTTCTCAGG + Intergenic
1062443824 9:136585108-136585130 GGACAGGGAGATGGGGCCAGTGG + Intergenic
1062486397 9:136778596-136778618 GGTCACGGAGCTGGAGACTGAGG - Intergenic
1062486474 9:136778939-136778961 GGTCACGGAGCTGGAGACTGAGG - Intergenic
1062534593 9:137015875-137015897 GGACAGGGAGGTGGGGCATGGGG + Intronic
1062629064 9:137455525-137455547 GGCCAGGGACCTGGGTCTTGAGG - Intronic
1186515995 X:10166499-10166521 GCACATGGCTCTGGGTCCTGAGG + Intronic
1187191760 X:17042461-17042483 GTCCACGCATCTGGGTCCTGCGG + Intronic
1188550528 X:31359697-31359719 AGGCACTGACCTGGGTCCTGGGG - Intronic
1189298206 X:39933963-39933985 AGGCTCTGAGCTGGGTCCTGGGG - Intergenic
1190176937 X:48158103-48158125 GGACAAGGAGCAGGGTCTCGGGG + Intergenic
1190188679 X:48257399-48257421 GGACAAGGAGCAGGGTCTCGGGG + Intronic
1190194354 X:48304669-48304691 AGACAAGGAGCAGGGTCTTGGGG - Intergenic
1190203637 X:48384211-48384233 GGACAAGGAGCAGGGTCTCGGGG + Intronic
1190206899 X:48411193-48411215 GGACAAGGAGCAGGGTCTCGGGG - Intronic
1191840790 X:65512472-65512494 TGACCAGGAGCTAGGTCCTGAGG - Intergenic
1192858549 X:75040215-75040237 GGACACGAGGCAGAGTCCTGGGG - Intergenic
1194391365 X:93321770-93321792 GAACACCAAGCTGGGTCTTGGGG - Intergenic
1197372337 X:125640310-125640332 GGTGATGGAGATGGGTCCTGAGG + Intergenic
1197626956 X:128813013-128813035 AGACACTGTGCTGGGTGCTGGGG - Intergenic
1199860997 X:151800532-151800554 AGACACTGTGCTGGGCCCTGAGG + Intergenic
1200000102 X:153055993-153056015 GGTCAGGGAGCCGGGTTCTGGGG - Intergenic
1200003024 X:153071958-153071980 GGTCAGGGAGCCGGGTTCTGGGG - Intergenic
1200004699 X:153078051-153078073 GGTCAGGGAGCCGGGTTCTGGGG + Intergenic
1200217048 X:154372467-154372489 GGACAGGGATCAGGGGCCTGGGG + Intronic
1200246910 X:154531342-154531364 GGACAAGGAAGTGGGTCCTCAGG + Intergenic
1201310895 Y:12597452-12597474 GGACACCCAGCTGGGTTCTGTGG + Intergenic