ID: 1183230763

View in Genome Browser
Species Human (GRCh38)
Location 22:36580499-36580521
Sequence CCACACTCCATAGCCAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183230763_1183230772 12 Left 1183230763 22:36580499-36580521 CCACTTCTGGCTATGGAGTGTGG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 1183230772 22:36580534-36580556 CCCATTGAGGCCTGTGTGTGTGG 0: 1
1: 0
2: 8
3: 126
4: 1115
1183230763_1183230766 -1 Left 1183230763 22:36580499-36580521 CCACTTCTGGCTATGGAGTGTGG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 1183230766 22:36580521-36580543 GCCTGGTGATCCCCCCATTGAGG 0: 1
1: 0
2: 0
3: 7
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183230763 Original CRISPR CCACACTCCATAGCCAGAAG TGG (reversed) Intronic
900333963 1:2151767-2151789 CAACACTCCAGAGGCTGAAGTGG - Intronic
902465716 1:16617139-16617161 CCTCACTCCATAGTGAGATGTGG - Intergenic
903588967 1:24440025-24440047 CCACACTCCAGACCCACAACTGG - Intronic
903764873 1:25727703-25727725 CCACACTCCCTGCCCAGAACTGG - Intronic
905892361 1:41525435-41525457 CAAGATCCCATAGCCAGAAGGGG + Intronic
907785294 1:57605587-57605609 ACACAGTCCATGGCAAGAAGTGG - Intronic
910172353 1:84391373-84391395 CCACATTCCAAAGACAAAAGAGG - Intergenic
913592459 1:120342049-120342071 CACCAATCCATCGCCAGAAGGGG - Intergenic
913650891 1:120913081-120913103 CACCAATCCATCGCCAGAAGGGG + Intergenic
914194442 1:145438297-145438319 CCGCACTCCATCGCGAGATGTGG - Intergenic
914474393 1:148011485-148011507 CCTCACTCCATAGTGAGATGTGG - Intergenic
914475771 1:148021179-148021201 CCGCACTCCATCGCGAGATGTGG - Intergenic
914641062 1:149607176-149607198 CACCAATCCATCGCCAGAAGGGG + Intergenic
915508348 1:156371606-156371628 CCACCCACCCTAGGCAGAAGGGG + Intronic
922085064 1:222338656-222338678 CCACACCCCATACCCACCAGGGG + Intergenic
923015957 1:230126878-230126900 CCTCACTCCAAATCCTGAAGGGG - Intronic
923808711 1:237288768-237288790 CCAGACTCCATAGGCAGGGGAGG - Intronic
1064620000 10:17205761-17205783 CCACAGTGCCCAGCCAGAAGAGG - Intergenic
1067686775 10:48470532-48470554 ACACCCTCTATACCCAGAAGAGG + Intronic
1069508783 10:69024634-69024656 CCATTCTCCTTAGACAGAAGTGG - Intergenic
1069888956 10:71641184-71641206 CCACACTGCATAGCCAGGGTTGG - Intronic
1075393942 10:122113395-122113417 CCACACTCCTCTGCCAGCAGGGG - Intronic
1075441215 10:122480539-122480561 CAACACTCCATGGCCAGCATGGG - Intronic
1077111020 11:862311-862333 CCACACTCCATGGCCACAGTCGG - Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1081678283 11:44983918-44983940 CCACAGTCCATAGTAAGAGGTGG + Intergenic
1085296626 11:75435157-75435179 ACACACTCCATTGCCACAGGGGG + Exonic
1087749641 11:101993207-101993229 CCACCCTCCATGGCCTCAAGTGG + Intronic
1093629714 12:21394383-21394405 ACACACACATTAGCCAGAAGTGG + Intronic
1094108745 12:26839153-26839175 CCACACCCCACAGCAAGCAGAGG - Intergenic
1097573969 12:61367899-61367921 ACACACAAAATAGCCAGAAGTGG - Intergenic
1098125923 12:67292843-67292865 CCTCCCTCCTTGGCCAGAAGGGG - Intronic
1099653135 12:85455576-85455598 CCACCCTCCACAGACAGCAGAGG - Intergenic
1100214770 12:92435980-92436002 CCACACTGCATACCAAAAAGAGG - Intergenic
1101739643 12:107491009-107491031 CCAGACTCCAAAGCCATATGGGG + Intronic
1102835607 12:116056017-116056039 CCACAGTACATAAGCAGAAGAGG + Intronic
1103717330 12:122952536-122952558 CCACAGTCCTTGGCCAGACGAGG + Intronic
1104918951 12:132280655-132280677 CCAGACTCCTGAGCCAGCAGAGG + Intronic
1106017061 13:25879576-25879598 CCAGAATCCATCGCCAGCAGAGG - Intronic
1106522717 13:30512009-30512031 CCACACACCATAGACATAATTGG + Intronic
1106583840 13:31039726-31039748 CCACACTCCATCTCCAGCACTGG - Intergenic
1109310173 13:60684010-60684032 CCTCACTGCTTAGGCAGAAGGGG - Intergenic
1109429409 13:62212445-62212467 CCACACCTCACAGCCAGCAGAGG + Intergenic
1113208161 13:107941664-107941686 CCACACTCCAGACCCTGGAGGGG - Intergenic
1113328494 13:109306831-109306853 CCTGCCTCTATAGCCAGAAGTGG + Intergenic
1113881418 13:113628844-113628866 CCACACTCAACAGCCAGAGGAGG - Intronic
1120121148 14:80681176-80681198 CCACACTCCCTAGCGAGGAAGGG + Intronic
1120840232 14:89078928-89078950 ACCCACACCACAGCCAGAAGGGG + Intergenic
1121954806 14:98204310-98204332 CCACACCTCATGGCCAGTAGGGG + Intergenic
1122049497 14:99046030-99046052 TCTGACTCCAGAGCCAGAAGTGG + Intergenic
1127320528 15:57840833-57840855 CCATACTCCATGGCCATATGTGG + Intergenic
1129606482 15:77027735-77027757 CCTCTCTCCAGAGCCAGGAGAGG + Intronic
1129756708 15:78103236-78103258 CTTCTCTCCTTAGCCAGAAGAGG + Intronic
1129938249 15:79469183-79469205 CCACACACCAAAGCAAGAACAGG - Exonic
1132120098 15:99168886-99168908 CCACACTCCAGACCCAGAGAGGG - Intronic
1136142963 16:28298932-28298954 TCCCCCACCATAGCCAGAAGGGG + Intronic
1137491827 16:48939325-48939347 CCTCATTCCATAGCCACCAGAGG + Intergenic
1138589462 16:57991841-57991863 CCTCACTCCATACCTATAAGGGG - Intergenic
1140905650 16:79406891-79406913 CCACATCCCAGAGCCAGTAGGGG + Intergenic
1141048625 16:80739998-80740020 CCACCCTCCACAGCCACATGGGG - Intronic
1145987367 17:29056053-29056075 TCACATCCCAAAGCCAGAAGTGG - Intronic
1146520242 17:33520669-33520691 CCACCCTTCATAGCCCCAAGAGG - Intronic
1146756602 17:35437635-35437657 CAGCACTCCATAGCAAGAAGTGG + Exonic
1146795105 17:35775030-35775052 CCTCACTTCACAGGCAGAAGAGG + Intronic
1148080720 17:44966688-44966710 ACACACTCCAGAGTCAGGAGGGG + Intronic
1149432937 17:56608918-56608940 CGATACTCCATAGTCAGAACAGG - Intergenic
1150137730 17:62704667-62704689 CCCCACCCCATCGCCTGAAGCGG + Intronic
1152206295 17:78976392-78976414 CTTCACTCCATAGACAGAACAGG + Intronic
1155950074 18:31902173-31902195 ACACCCTCAACAGCCAGAAGTGG + Intronic
1159800718 18:72895986-72896008 CCAAACTTCATAACAAGAAGGGG + Intergenic
1159965582 18:74592345-74592367 TCACATCCCATGGCCAGAAGTGG - Intergenic
1160011379 18:75109241-75109263 CCACCCACCATAGCCAGGATAGG - Intergenic
1160622109 18:80178893-80178915 CCTCACTCCCTCCCCAGAAGAGG - Intronic
1162915516 19:13872747-13872769 CCCCACTCCACAGCCTGAATGGG + Intronic
1163638570 19:18449292-18449314 CCACACCCCACAGCCAGACCTGG - Intronic
1164982131 19:32622011-32622033 CCACACTCGATGTCCAGAACTGG + Intronic
1165724127 19:38100803-38100825 CCACCCGCCATAGCGAGAAGAGG + Intronic
1166505216 19:43367145-43367167 CCACACCTCAAAGCCAGAAAAGG + Intergenic
1166509341 19:43393950-43393972 CCACACCTCAAAGCCAGAAAAGG - Intergenic
1166838738 19:45683357-45683379 CCTCACTCCGCAGCCAGCAGTGG - Exonic
1167181783 19:47909532-47909554 CTTCACTGCATAGACAGAAGAGG + Intergenic
1167182433 19:47914922-47914944 CTTCACTGCATAGACAGAAGAGG + Intergenic
1167183100 19:47920274-47920296 CTTCACTGCATAGACAGAAGAGG + Intergenic
1167184398 19:47930674-47930696 CTTCACTGCATAGACAGAAGAGG + Intergenic
925147581 2:1591472-1591494 CCACACTCCACGGCCAGGCGGGG + Intergenic
926563190 2:14440032-14440054 CCACACTCCATAGCAATGAAAGG + Intergenic
929043900 2:37772461-37772483 CCAAACTCCATGAACAGAAGTGG + Intergenic
930062803 2:47304844-47304866 CCAAACTGCATGCCCAGAAGCGG - Intergenic
932160463 2:69455124-69455146 ACACCCTTCATAGCCAGAAGAGG - Intergenic
933655731 2:84885517-84885539 CATCACTCCTTAGTCAGAAGAGG - Intronic
933777360 2:85779116-85779138 CCGCACTGCAGAGCCAGAAGAGG - Intronic
934906227 2:98206722-98206744 CCTCACTCCCTAGCCAAGAGTGG + Intronic
935017516 2:99198040-99198062 CAACAGCCCATAGCTAGAAGAGG + Intronic
936260055 2:110951100-110951122 CCCCATTCCCTAACCAGAAGTGG - Intronic
939671442 2:145017548-145017570 CCACACTTTGGAGCCAGAAGAGG + Intergenic
939818570 2:146927477-146927499 ACCCAGTCCAGAGCCAGAAGGGG + Intergenic
940048865 2:149439632-149439654 CCACACTACTGAGGCAGAAGTGG - Intronic
941014447 2:160338824-160338846 ACCCACTCAATAGGCAGAAGAGG + Intronic
941870367 2:170378238-170378260 CCAAACCCCATAGCCAGAGGAGG + Intronic
945836321 2:214839609-214839631 CTACACACCATAAGCAGAAGCGG - Intergenic
946389132 2:219404999-219405021 CCCCACTCCCCAGCCAGAAAAGG - Intergenic
948857862 2:240738615-240738637 CCAAACCCCTTAGCCTGAAGGGG + Intronic
1168759637 20:341078-341100 CCCCACACCATGGACAGAAGGGG - Intergenic
1168809537 20:695432-695454 CCAGATTCCATGGGCAGAAGTGG - Intergenic
1169339187 20:4783105-4783127 CCACACTCAGTAGCAAGATGAGG + Exonic
1173164075 20:40673953-40673975 CCAGTCTCCACAGCCAGAAGAGG + Intergenic
1174337902 20:49876367-49876389 CCACACGCCAAGGCCAGAAGTGG - Intronic
1174474424 20:50786270-50786292 CCACTCTCTGTACCCAGAAGGGG + Intergenic
1179192771 21:39137333-39137355 CCACACTCCTGAGTCAGCAGAGG + Intergenic
1179446275 21:41433120-41433142 CCACAGTCTATCCCCAGAAGTGG - Intronic
1181760392 22:25054446-25054468 CCACCCTGCATACACAGAAGAGG - Intronic
1183230763 22:36580499-36580521 CCACACTCCATAGCCAGAAGTGG - Intronic
1183709379 22:39493494-39493516 ACACCCTACCTAGCCAGAAGAGG + Intergenic
1185065150 22:48628364-48628386 CCACACTCCAGAGGCAAAGGGGG - Intronic
1185156865 22:49198278-49198300 CCTCACTCCACAGGCAGATGTGG + Intergenic
952880508 3:37983020-37983042 CTTCACTCCATCGTCAGAAGTGG - Exonic
954377975 3:50204961-50204983 ACACCCCCCAAAGCCAGAAGGGG - Intergenic
955699166 3:61666398-61666420 CCACACACCCTTCCCAGAAGGGG - Intronic
963761224 3:149288791-149288813 CCACACCCAATGGCCACAAGGGG + Intergenic
968597540 4:1493164-1493186 CCACACGCCAGAGCCTGTAGCGG + Intergenic
969227999 4:5811683-5811705 TCACACACCACAGCCAGGAGGGG + Exonic
969228061 4:5811970-5811992 TCACACACCACAGCCAGGAGAGG + Exonic
969228088 4:5812086-5812108 CCTCACACCACAGCCAGGAGAGG + Exonic
969228131 4:5812260-5812282 CCTCACACCACAGCCAGGAGAGG + Exonic
969228159 4:5812375-5812397 CCTCACACCACAGCCAGGAGAGG + Exonic
969228181 4:5812490-5812512 CCACACACCACAGCCAGGAGAGG + Exonic
971862916 4:32131319-32131341 CCCCACTCCACACCCAGAACAGG + Intergenic
978189010 4:105892104-105892126 CCACACCCCATACACAGTAGTGG - Intronic
978318428 4:107465911-107465933 CCACCTTTCATACCCAGAAGGGG + Intergenic
978931236 4:114315048-114315070 ACAAACTACATAGCCAGAAAAGG + Intergenic
984454950 4:179953934-179953956 CTATAACCCATAGCCAGAAGAGG - Intergenic
985042364 4:185904430-185904452 CCACAGTCCAAAGCCTGAAGAGG - Intronic
986106654 5:4666165-4666187 CCACCTTCCATCGCCATAAGGGG - Intergenic
989105487 5:37859123-37859145 CCACCATCCCTGGCCAGAAGAGG - Intergenic
992543432 5:77786317-77786339 CCATTCTCCTTAGACAGAAGTGG - Intronic
992994235 5:82316723-82316745 CATCACTCCATAGACACAAGGGG - Intronic
993992742 5:94679887-94679909 CCAAACTCCATAGCCAGTTTAGG + Intronic
998484989 5:142494126-142494148 ACACACTCTAAAGCCAGAAAAGG - Intergenic
998787348 5:145727242-145727264 ACACACTCCAAAGCCATGAGGGG + Intronic
998787675 5:145730070-145730092 ACACATTCCAGAGCCACAAGGGG + Intronic
999069465 5:148728464-148728486 CCACACTGCATATACAGAAGAGG + Intergenic
1002571840 5:180144030-180144052 CCAGTCTCCATAACCTGAAGAGG - Intronic
1005988932 6:30891490-30891512 CCAAACTCCATATCCTGCAGGGG - Intronic
1006793495 6:36718164-36718186 CCCCATTCCTTAGCCAGCAGAGG - Intronic
1006982176 6:38155439-38155461 CAACAGTCCACAGCAAGAAGAGG + Intergenic
1011954220 6:93005216-93005238 CCACACTCCTTGGCCAGCAGAGG + Intergenic
1013623268 6:111911256-111911278 CCACTCTCCATAGTCAGAAAGGG + Intergenic
1014132001 6:117845861-117845883 CCACTCTCCCTTGCCAGATGGGG + Intergenic
1018092446 6:160356609-160356631 CCCCACTCCATAGCCATGAAGGG - Intronic
1018925261 6:168201473-168201495 CAAGACTCCACAGCCAGCAGGGG - Intergenic
1018939841 6:168301820-168301842 CCACACTTCAAAGCCGGCAGTGG + Intronic
1019435360 7:1019779-1019801 CCACACTCCATCAGGAGAAGAGG - Intronic
1021498295 7:21300845-21300867 CCTCCCACCATATCCAGAAGGGG + Intergenic
1021878780 7:25073690-25073712 CCACACTGCAGAGCCAAAATAGG - Intergenic
1024354780 7:48403331-48403353 CCATACTCCATACCCTGTAGAGG + Intronic
1024536881 7:50443033-50443055 CTAAACTCCATAGAAAGAAGTGG + Intergenic
1026229674 7:68471959-68471981 CCACTGACAATAGCCAGAAGAGG - Intergenic
1026561685 7:71455681-71455703 CCACACTCCCCAGCCAGCACGGG + Intronic
1026933513 7:74238451-74238473 CCACCCTCCAGGGGCAGAAGTGG + Intronic
1027266900 7:76499512-76499534 CCAGACTCCAGGACCAGAAGGGG - Intronic
1027318715 7:76999380-76999402 CCAGACTCCAGGACCAGAAGGGG - Intergenic
1027539856 7:79453462-79453484 CCACACTCCATCCAAAGAAGAGG - Exonic
1031221528 7:118972525-118972547 CCACAGTGCCCAGCCAGAAGTGG + Intergenic
1031730595 7:125295427-125295449 ACACACACAATAACCAGAAGAGG + Intergenic
1033561245 7:142534107-142534129 TCTCACTCCATAACCAGATGTGG + Intergenic
1041145052 8:54866669-54866691 CCACCCACCATATCAAGAAGTGG + Intergenic
1047769623 8:128020443-128020465 CCACATTTCAGAGCCAGCAGTGG - Intergenic
1053465135 9:38301512-38301534 CCACAGTGTATGGCCAGAAGCGG - Intergenic
1055534400 9:77223081-77223103 GCAGCCTCCAGAGCCAGAAGAGG - Intronic
1056136758 9:83637360-83637382 CCACTCTCCATAGAAGGAAGAGG - Intronic
1057498464 9:95578404-95578426 CCACACTCCATGGCCATTGGTGG - Intergenic
1186096711 X:6110319-6110341 CCTCACTCCTTATCCACAAGAGG + Intronic
1186283827 X:8023119-8023141 CCACACTACATTGCCAATAGAGG - Intergenic
1190725174 X:53185292-53185314 CCATCCTTAATAGCCAGAAGAGG - Intergenic
1193318474 X:80092631-80092653 CCACACTGCTTAGCCAAGAGTGG + Intergenic
1193365240 X:80623604-80623626 CCCCACTCCCTAGCCAAAACAGG - Intergenic
1196268513 X:113682152-113682174 CCACACTCTCTACCCAGAAGGGG + Intergenic
1200291978 X:154884168-154884190 CCACTCACAATAGCCAGAAGGGG + Intronic
1200338816 X:155379905-155379927 CCACTCACAATAGCCAGAAGGGG + Intergenic
1200347653 X:155460787-155460809 CCACTCACAATAGCCAGAAGGGG - Intergenic