ID: 1183232935

View in Genome Browser
Species Human (GRCh38)
Location 22:36594103-36594125
Sequence GATCCAGGTGCTCCAAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183232930_1183232935 9 Left 1183232930 22:36594071-36594093 CCCAGGGGTTGTGATGGCTTCAG 0: 1
1: 0
2: 1
3: 9
4: 185
Right 1183232935 22:36594103-36594125 GATCCAGGTGCTCCAAAATCTGG 0: 1
1: 0
2: 2
3: 13
4: 125
1183232928_1183232935 13 Left 1183232928 22:36594067-36594089 CCACCCCAGGGGTTGTGATGGCT 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1183232935 22:36594103-36594125 GATCCAGGTGCTCCAAAATCTGG 0: 1
1: 0
2: 2
3: 13
4: 125
1183232929_1183232935 10 Left 1183232929 22:36594070-36594092 CCCCAGGGGTTGTGATGGCTTCA 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1183232935 22:36594103-36594125 GATCCAGGTGCTCCAAAATCTGG 0: 1
1: 0
2: 2
3: 13
4: 125
1183232931_1183232935 8 Left 1183232931 22:36594072-36594094 CCAGGGGTTGTGATGGCTTCAGG 0: 1
1: 1
2: 9
3: 68
4: 550
Right 1183232935 22:36594103-36594125 GATCCAGGTGCTCCAAAATCTGG 0: 1
1: 0
2: 2
3: 13
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183232935 Original CRISPR GATCCAGGTGCTCCAAAATC TGG Intronic
904433986 1:30482407-30482429 GTTCCAGCTCCTCCAAAAACAGG + Intergenic
908400448 1:63768067-63768089 GATCCAGTTGCTCCACATCCTGG + Intergenic
911292100 1:96069596-96069618 GATCTTGGTGCTCCAGTATCGGG + Intergenic
912847928 1:113093237-113093259 GATGTAGGTTCTCCAAAATACGG - Exonic
913030319 1:114896232-114896254 GAACTAGGAGCTGCAAAATCAGG - Intronic
913185528 1:116367461-116367483 CATCCAAGTCCTCCACAATCTGG + Intergenic
914977083 1:152376015-152376037 CAACCAGTTGCTCCAAATTCTGG + Intergenic
916625364 1:166550111-166550133 AATCCAGGTGCTCCTATATTGGG + Intergenic
916902156 1:169238516-169238538 GATCCAGATGATCCAGAATATGG - Intronic
917725859 1:177826468-177826490 GATTCAGGAGCCCCAAAATGGGG + Intergenic
917819431 1:178747284-178747306 GATTGAGGGACTCCAAAATCTGG + Intronic
918378396 1:183931613-183931635 GATCCAGGTGGTCTTAAAACTGG - Intronic
918689905 1:187467155-187467177 GATCCAGGCTTTCCTAAATCAGG + Intergenic
918859411 1:189802851-189802873 GATCAAGGTGCTGGCAAATCAGG + Intergenic
920406384 1:205715871-205715893 GATACAGGTGCTCAATAGTCAGG - Exonic
1064155619 10:12901018-12901040 GATACAGGTGCTCCAAAGAAGGG - Intronic
1066252231 10:33645798-33645820 GCTCCAGGAGCTTCACAATCTGG + Intergenic
1066662965 10:37754538-37754560 GATCCAGGTTCTCTAAGCTCAGG + Intergenic
1067546959 10:47198968-47198990 GATCCTCCTTCTCCAAAATCAGG + Intergenic
1069729182 10:70600169-70600191 CATCCAGGAGGTCCCAAATCTGG - Intronic
1070144775 10:73765807-73765829 GATCCAGGTGCTGAAAATACTGG - Exonic
1070591567 10:77805590-77805612 GATCCAGGAGCTCCACAACAGGG - Intronic
1072659824 10:97357000-97357022 GCTCCAGGTGCTCAAGATTCTGG - Exonic
1074247860 10:111713135-111713157 GATCAAGGAGCTCCAAGGTCTGG + Intergenic
1074350270 10:112729973-112729995 AATCCAGGGGCCCCAACATCAGG + Intronic
1077746192 11:4908772-4908794 TTTTTAGGTGCTCCAAAATCTGG - Intronic
1092674417 12:10900457-10900479 AAAGCAGGTGCTCCAATATCTGG - Intronic
1094238379 12:28193688-28193710 GTTCCAGTTGCTCCACATTCTGG + Intronic
1094423752 12:30298312-30298334 GTTCCAGGTGCCCCCACATCTGG - Intergenic
1095601176 12:44014498-44014520 GATGCTGATGCTCCTAAATCTGG + Intronic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1101125075 12:101625066-101625088 GATCCAGGTGTTTAAAAATCGGG + Intronic
1101506663 12:105353195-105353217 GATCCAGGTGATCAAACAACAGG + Intronic
1103479304 12:121240926-121240948 GAGCCAGCTGCTCCCACATCTGG + Intronic
1105430743 13:20334969-20334991 GATCCATGTTTTTCAAAATCTGG + Intergenic
1106527457 13:30554210-30554232 GATTCAGGGACTCCAAAATCTGG - Intronic
1108863163 13:54887970-54887992 GTTACAGATGCTCCAAGATCTGG - Intergenic
1109397776 13:61783100-61783122 GAACCAGGTGGGCAAAAATCAGG - Intergenic
1110670385 13:78169957-78169979 GATTCAGGTTCTCTAAACTCAGG + Intergenic
1111040175 13:82738173-82738195 AATCCAGGTGCTCCAATGTTGGG + Intergenic
1111432741 13:88164208-88164230 GATCCAGGTGCTGTGTAATCAGG - Intergenic
1113085919 13:106569473-106569495 GATCCAGGTGCTAGCCAATCTGG + Intergenic
1113408609 13:110064275-110064297 GACACAGGTGCCCCAAAATTCGG + Intergenic
1116222956 14:42111941-42111963 CATACAGGTGCTCCAATATCTGG + Intergenic
1117331193 14:54713439-54713461 GAGCAGGGGGCTCCAAAATCTGG + Intronic
1119114834 14:72009661-72009683 GATCTAGGTGCTCCTAGCTCAGG - Intronic
1122534558 14:102453097-102453119 GATGCAGGTCCTCCTATATCTGG - Intronic
1202852704 14_GL000225v1_random:31124-31146 CACCCAGGTGCTCCAGGATCCGG + Intergenic
1123540433 15:21284313-21284335 GATCAAAGTGTTCCAAAATGGGG - Intergenic
1124843906 15:33271889-33271911 TATCCAGGTGCTCCAGTATTGGG + Intergenic
1126551001 15:49929176-49929198 AACCCAGGTTTTCCAAAATCTGG - Intronic
1129975384 15:79817102-79817124 GATCCCTTTGCCCCAAAATCAGG + Intergenic
1202948747 15_KI270727v1_random:11455-11477 GATCAAAGTGTTCCAAAATGGGG - Intergenic
1132552288 16:558538-558560 CATCTAGGTGCTCCAAGACCAGG + Intergenic
1138500811 16:57442851-57442873 GATCCACGGCCTCCATAATCTGG + Intronic
1139466014 16:67154613-67154635 CATCCAGGTTCTCCAAAAGCTGG + Exonic
1140123962 16:72105243-72105265 CCTCCAGATGCTCCACAATCTGG - Exonic
1142851673 17:2707571-2707593 GGTCCAGGTACCCCAAATTCTGG - Intronic
1143858038 17:9867141-9867163 GATCCATGTTCCCCAAAATTGGG - Intronic
1147816447 17:43214050-43214072 GGTCCAGGAGCTTCTAAATCAGG - Intronic
1148093179 17:45034813-45034835 GATCCAGGTGTTCCAGCAGCTGG - Exonic
1152701134 17:81820201-81820223 GACCCAGGTGAGCCCAAATCAGG + Intergenic
1154259450 18:12817298-12817320 GATTCAGGGACTCCAAAATCTGG + Exonic
1156129251 18:33949590-33949612 GATCCACGGGCTCCAATTTCAGG - Intronic
1166507611 19:43380996-43381018 CACCCAGGTGCTCCAGAATCTGG - Intergenic
929889458 2:45907033-45907055 GCCCCAGTTGCTCCAAAATTAGG + Intronic
934469172 2:94500002-94500024 GTTCCAGATACTACAAAATCAGG + Intergenic
935270532 2:101430582-101430604 GATCAAGGTACCCCAAAATTTGG - Intronic
935400117 2:102651429-102651451 GCTCAAGGTGCTCCCAACTCAGG + Intronic
936024738 2:109022418-109022440 GATCCAGGTGCTCAGAAAGGTGG + Intergenic
936535470 2:113307788-113307810 AGTCCAGGAGCTTCAAAATCAGG - Intergenic
939908967 2:147956042-147956064 TATCCAGGTGCTCCAGATTGTGG + Intronic
940415627 2:153416853-153416875 GATTCAGGTGCTACAAAAGTTGG - Intergenic
941397638 2:164992825-164992847 GATCAAAGTGTTCCAAAATGGGG - Intergenic
943198311 2:184784920-184784942 GACCCAGTGCCTCCAAAATCAGG + Intronic
944308861 2:198209408-198209430 GATCCAGGAGCTCAAATATCAGG - Intronic
944658503 2:201900530-201900552 GAGCCAGGTGGTACACAATCAGG + Intergenic
945363693 2:208925025-208925047 AATCTGGGTGCTCCAAAATAGGG + Intergenic
1174444020 20:50578465-50578487 GATTCAGGGACTCCAAAGTCAGG - Exonic
1175134428 20:56812304-56812326 GATCCAGGGACTCAAATATCAGG + Intergenic
1178147567 21:29757291-29757313 AAAGCAGGAGCTCCAAAATCAGG + Intronic
1179481623 21:41682128-41682150 GGTCCAGGTGCCCCAGAGTCTGG - Intergenic
1181116672 22:20635946-20635968 GACCCAGATGCTCCAAAAAGAGG + Intergenic
1183232935 22:36594103-36594125 GATCCAGGTGCTCCAAAATCTGG + Intronic
953992642 3:47496046-47496068 GCTTCAGCTGCTCCGAAATCAGG + Exonic
954998781 3:54906990-54907012 GATCCAGTTTCTCAAAACTCTGG - Intronic
957757914 3:84514632-84514654 GATTTGGGTGCTCCAATATCAGG + Intergenic
959618658 3:108376277-108376299 GATCCAGGTGCTCCAAAGCCGGG - Intronic
970175590 4:13336344-13336366 CTTCCAGGTCCTCCAAAAGCTGG - Intergenic
974150336 4:57999244-57999266 GATTCAGATGCTCAAACATCAGG + Intergenic
975308286 4:72873954-72873976 GATACATGTGCTGAAAAATCAGG - Intergenic
975661730 4:76695526-76695548 GCTCAAGGTTCTCCAGAATCTGG - Intronic
976592572 4:86863636-86863658 GATCCAAGTCCTCAATAATCAGG + Intergenic
978733074 4:112053360-112053382 GATCCAGTTTCTCCACATTCTGG + Intergenic
979444208 4:120791949-120791971 GATCAAGGTGCTGGCAAATCTGG - Intronic
980675149 4:136068833-136068855 AATCCAGGTGCTCCAATGTTGGG - Intergenic
982822772 4:159964750-159964772 CATCTGGGTGCTCCAACATCAGG + Intergenic
983683751 4:170383126-170383148 TATCCAGGTGCTCCAGTATTGGG + Intergenic
986701429 5:10413027-10413049 GCTCAAGGTGCTCCATTATCTGG - Intronic
987234416 5:15928473-15928495 CATCCAGGTGCTCCAGATTAGGG - Exonic
987306216 5:16640288-16640310 GAACCAGGTGCTCCAAGGACAGG + Intergenic
988404593 5:30807708-30807730 GATTCTGGTCCTCCAAAAGCAGG + Intergenic
989084375 5:37659655-37659677 GATCCAGGTGCCCCCAGATTTGG + Intronic
993990904 5:94657684-94657706 GATCTAGGTGCTCCAAGATCTGG + Intronic
995105051 5:108367848-108367870 GATCCAGCTGCTTCCAAAACTGG + Exonic
998262890 5:140644695-140644717 GATGCAGCAGCTCCAAACTCTGG - Exonic
999416709 5:151404083-151404105 AATCCAGGTGCTCCAATATTGGG + Intergenic
1000125699 5:158241632-158241654 GATCAAGTTACTCCAAAATTTGG - Intergenic
1005706005 6:28453999-28454021 GATTCAGGTTCTACAAAACCTGG + Intergenic
1009642908 6:66361530-66361552 GATCAAGGTGCTATGAAATCCGG + Intergenic
1010324701 6:74550846-74550868 GATCCCCGTGGTCCAAACTCGGG - Intergenic
1010789154 6:80044725-80044747 GAACCAGGTGATGCAAAATCAGG + Intergenic
1011085707 6:83538095-83538117 AATCCACGTGATCCAAAATACGG + Intergenic
1012038093 6:94168696-94168718 AATGCAGGTGCTCCAATATCGGG - Intergenic
1013564571 6:111344864-111344886 GATCCAGGAGGTACAAAATAGGG + Intronic
1014162271 6:118184287-118184309 GAGCCAGGTACTCCATCATCTGG - Intronic
1022418477 7:30198293-30198315 GCTCCAGGTGTTCCCAAATCAGG - Intergenic
1023407960 7:39856217-39856239 GATCAAGGTGCTGCAAGATTTGG + Intergenic
1023516335 7:41005504-41005526 GCTCCAGCTGTTCCAAAAGCTGG + Intergenic
1024404275 7:48960419-48960441 TTTCTAGTTGCTCCAAAATCTGG - Intergenic
1024566591 7:50686317-50686339 GATCAAGGTGCTCCCAGATCTGG - Intronic
1032475433 7:132208539-132208561 GAGCCAGGAGCTTCAACATCAGG + Intronic
1032542582 7:132715623-132715645 GGACCAGGTGCTCCAAAGGCAGG + Intronic
1034871605 7:154690122-154690144 CATCCAGGTGGTCCACAATATGG + Intronic
1035030579 7:155855342-155855364 TATTTAGGTGCTCCAAAATTTGG - Intergenic
1039270379 8:35874220-35874242 GCTTCAGGTGCTCCAAATTAGGG - Intergenic
1039569787 8:38577515-38577537 GAACCAGGCTCTGCAAAATCAGG - Intergenic
1042035581 8:64529975-64529997 GTTCCAGGTGCTTCAAATTCTGG - Intergenic
1042205050 8:66320257-66320279 AATCTAGGTGCTCCAATATTGGG - Intergenic
1044315238 8:90743132-90743154 AATCCACGTGCTCCAATATTAGG + Intronic
1045819346 8:106317616-106317638 GATCAAGGTGCTCAAAAACAGGG + Intronic
1048596479 8:135872207-135872229 AATCCAAGTGCTGCAAAATATGG - Intergenic
1048863287 8:138739825-138739847 GATCCAGGGGCTTCTAAACCAGG - Intronic
1053414573 9:37938978-37939000 CACCCAGCTGCTCCGAAATCTGG + Intronic
1056242650 9:84664161-84664183 GTTCCAGTTGCTCCACATTCTGG + Intergenic
1056665435 9:88577520-88577542 GATCTAGGTGCTGTCAAATCTGG + Intronic
1060052790 9:120389040-120389062 GGTGCAGGTGCTCCACAAACGGG - Exonic
1060671545 9:125474206-125474228 GATCCTGGTGCTCCCAAGACTGG - Intronic
1062497433 9:136838358-136838380 GATCCAGGTGCTGCAGAGACAGG + Intronic
1188830068 X:34885578-34885600 AACCCAGGTTCTCCAAAACCTGG - Intergenic
1193979717 X:88167312-88167334 AATCTAGGTGCTCCAATATTGGG + Intergenic