ID: 1183237459

View in Genome Browser
Species Human (GRCh38)
Location 22:36630285-36630307
Sequence CTGTGGGCGTGGACAGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 1, 2: 1, 3: 31, 4: 350}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183237447_1183237459 16 Left 1183237447 22:36630246-36630268 CCCAGTGGGAAGCCTTGGTGGCC 0: 1
1: 0
2: 0
3: 10
4: 156
Right 1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG 0: 1
1: 1
2: 1
3: 31
4: 350
1183237454_1183237459 -5 Left 1183237454 22:36630267-36630289 CCTGGGTGGAGGTAGAAGCTGTG 0: 1
1: 0
2: 1
3: 12
4: 274
Right 1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG 0: 1
1: 1
2: 1
3: 31
4: 350
1183237448_1183237459 15 Left 1183237448 22:36630247-36630269 CCAGTGGGAAGCCTTGGTGGCCT 0: 1
1: 0
2: 0
3: 20
4: 176
Right 1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG 0: 1
1: 1
2: 1
3: 31
4: 350
1183237453_1183237459 4 Left 1183237453 22:36630258-36630280 CCTTGGTGGCCTGGGTGGAGGTA 0: 1
1: 0
2: 3
3: 36
4: 490
Right 1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG 0: 1
1: 1
2: 1
3: 31
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183237459 Original CRISPR CTGTGGGCGTGGACAGGAGA TGG Intronic
900294982 1:1944227-1944249 CCGTGTGCGTGGACAGGAGGGGG + Intronic
900295000 1:1944303-1944325 CCGTGTGCATGGACAGGAGGGGG + Intronic
900663034 1:3795648-3795670 ATGTTGGTGTGGCCAGGAGAAGG + Intronic
900680851 1:3915397-3915419 CTGTGGGGGTGGCTAGGGGAGGG - Intergenic
900800435 1:4733748-4733770 TTGTGGGCAGGGATAGGAGAAGG + Intronic
901146093 1:7065539-7065561 CTGGAGGAGGGGACAGGAGATGG + Intronic
902439184 1:16418159-16418181 CTGTGGGGGAGAAGAGGAGAGGG - Intronic
903917248 1:26773509-26773531 CTGGGGGAGTGGACAGGAGCTGG - Intronic
904009050 1:27379709-27379731 CTGTGGCTGTGGGCAGGAGCTGG - Exonic
906190153 1:43893667-43893689 ATCTGGGCCTGGAGAGGAGATGG - Intronic
906245248 1:44268831-44268853 CTTTGTGGGTGGAAAGGAGAGGG - Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908574046 1:65440483-65440505 GTGTGGGCGTGAACGGGTGACGG + Intronic
909449667 1:75784518-75784540 CTGTGTGTGTGGCGAGGAGAGGG + Intronic
910176662 1:84438018-84438040 CTGAGGGCCTGTAAAGGAGAAGG + Intergenic
912379995 1:109242197-109242219 ATGTGGGCAGGGTCAGGAGATGG + Intergenic
912474213 1:109925360-109925382 CTGAGGACCTGGAAAGGAGAGGG - Intronic
913073483 1:115321699-115321721 CTGTGGCCTTGGACATGAAAAGG - Intronic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
914666881 1:149840056-149840078 CTGTGGACATGGACAGGGAACGG + Exonic
914668886 1:149853734-149853756 CTGTGGACATGGACAGGGAACGG - Exonic
917240699 1:172945396-172945418 CTGTGGTCCAAGACAGGAGAAGG - Intergenic
917727254 1:177839590-177839612 GTGTCGGGGTGGAGAGGAGAAGG - Intergenic
917749414 1:178040722-178040744 GTGAGGGCGAGGACAGGGGAAGG - Intergenic
917807725 1:178628840-178628862 CAGTGAGCCTGGACAGGTGAAGG - Intergenic
920597068 1:207282680-207282702 GTGTGGGCGTGGACAGGGCAGGG + Intergenic
921164732 1:212498663-212498685 CTGTGGTCGTGGGCGGGAGGGGG + Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922557819 1:226546451-226546473 GTGTGGGCAGAGACAGGAGATGG - Intergenic
922565683 1:226600331-226600353 GTGTGGGCATGGCCAGGATATGG + Intronic
922669012 1:227494897-227494919 CTGGGGGTGGGGATAGGAGAGGG - Intergenic
922670585 1:227506405-227506427 CTGGGGGTGGGGATAGGAGAGGG + Intergenic
922705435 1:227788071-227788093 CTGTGGGTGTGGCCAGGCGGGGG + Intergenic
923024928 1:230196598-230196620 GTGTGGGTCTTGACAGGAGATGG + Intronic
924441830 1:244092650-244092672 CTGTGGGCATGATAAGGAGAAGG - Intergenic
1062858199 10:790072-790094 CTGTGGGCCTGGGCACGTGAGGG - Intergenic
1065382218 10:25101948-25101970 CTGTAGGCAGGAACAGGAGATGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067702011 10:48580524-48580546 CTGTGGGCTGGTACAGGAGGAGG + Intronic
1067725973 10:48771332-48771354 CTGCCCGCGTGGAGAGGAGATGG + Intronic
1068087761 10:52395877-52395899 CTGTAGGTGTGCACAGAAGAGGG - Intergenic
1068117794 10:52752994-52753016 CTGTGGGCTTGGACAGGAGAAGG + Intergenic
1068460494 10:57322262-57322284 CTGTGGGAGGGGACCGGAGGGGG - Intergenic
1069041422 10:63699476-63699498 GTGTGGAAGTGGAGAGGAGAGGG + Intergenic
1071507821 10:86243287-86243309 CTCTGGGGGAGGACAGGATAGGG + Intronic
1073330760 10:102668724-102668746 CTGTGGGCGTGGGTTGGGGAGGG + Intergenic
1074364093 10:112844382-112844404 CTGAGGTCATGGAAAGGAGAAGG + Intergenic
1075418016 10:122279835-122279857 CTGTCTGCTTGGACAGGAGCTGG + Intronic
1075834648 10:125443320-125443342 TTGTGAGCCTGGACAGGGGACGG - Intergenic
1075863312 10:125696322-125696344 ATGTGGGTGGGGAAAGGAGAGGG + Intergenic
1076619129 10:131775793-131775815 AGGTGGGAGTGGAGAGGAGAAGG + Intergenic
1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG + Intronic
1077087799 11:763289-763311 GTGAGGGCGGGGACAGGTGAGGG - Intronic
1077195707 11:1278977-1278999 GTGTGGGCAGGGACAGGCGATGG - Intronic
1077216055 11:1395588-1395610 CAGTGGGTGGGGACAGGACAAGG - Intronic
1077225301 11:1436859-1436881 CAGTGGGAGTGGCCAAGAGAGGG + Intronic
1077292252 11:1803274-1803296 CTGTGGGCAGGGCCAGGAGGGGG + Intergenic
1079224679 11:18595247-18595269 CTGGGGGCTTGGACAGGGGTGGG + Intergenic
1079545131 11:21624684-21624706 CTGTGGCACTGGACATGAGATGG + Intergenic
1082009162 11:47438699-47438721 CTGGGGGGGTGGACAGGGGTGGG - Intronic
1083784074 11:64933897-64933919 CTGGGCCCCTGGACAGGAGAAGG - Exonic
1084266735 11:68008869-68008891 CTGTGGGTGTGGACAGGCAGGGG - Intronic
1084601812 11:70150133-70150155 CCGTGGGGGTGGAGAGGAAATGG + Intronic
1084695103 11:70748398-70748420 TTGTGGGGGTGGGCAGGGGACGG - Intronic
1085721215 11:78913932-78913954 CTGTTAGCCTGGAGAGGAGAAGG + Intronic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1088843260 11:113644281-113644303 CTGTGGGGGTGGGGAGGAGCTGG - Intergenic
1088848065 11:113684033-113684055 CTGAGAGCATGGCCAGGAGACGG + Intergenic
1089648467 11:119895646-119895668 CTGTGGGCCTGCGCAGGAGGAGG - Intergenic
1089905437 11:122033193-122033215 CATTGGGCATGTACAGGAGAGGG + Intergenic
1089907912 11:122064205-122064227 GTGTGGGAGTGGACATCAGAAGG + Intergenic
1090608816 11:128451971-128451993 CTTTGGGCGTGGAAAGGCGAAGG - Intergenic
1091085187 11:132714893-132714915 CTGAGGGCTTGGAGAGGAAATGG + Intronic
1091780996 12:3214609-3214631 TTCTGGGCCTGGGCAGGAGATGG + Intronic
1091793351 12:3283867-3283889 GAGGGGGCGTGGACAGGACACGG + Exonic
1092264382 12:6969970-6969992 CTGTGGTCGTGGAGAGGAGCAGG - Intronic
1092920279 12:13224875-13224897 CTGTAGGGGTGGACATGGGAGGG + Intergenic
1095169527 12:39018498-39018520 CTGTGAGCTTGGATAGGAAATGG - Intergenic
1095498600 12:42811938-42811960 CTGTGGGAGTGGAGAAGGGAGGG + Intergenic
1097234875 12:57532531-57532553 CTGAGGGAGTGGAAAGGAGATGG + Intronic
1097889220 12:64760268-64760290 CGGTGGGCGGTGAGAGGAGAGGG - Intergenic
1100794338 12:98164482-98164504 CTGGGGGAGGGGACTGGAGATGG - Intergenic
1100825391 12:98470130-98470152 CTGTTGGTGAGGCCAGGAGATGG + Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101421920 12:104557474-104557496 CACCGGGCGGGGACAGGAGAAGG + Intronic
1101536182 12:105618820-105618842 CTGTGTGGGGGGACAGGAGTGGG - Intergenic
1103468411 12:121160515-121160537 CTGTGGCCAGGGACAGGGGAAGG - Intronic
1104814261 12:131637008-131637030 CTCTGGGCCTGGACAGGACCAGG + Intergenic
1104964472 12:132502786-132502808 GAGGGGGCGGGGACAGGAGAGGG - Intronic
1104964492 12:132502834-132502856 GAGGGGGCGGGGACAGGAGAGGG - Intronic
1104964503 12:132502866-132502888 GAGAGGGCGGGGACAGGAGAGGG - Intronic
1105821104 13:24081851-24081873 CTGTGGGCGTGGAAAGTGAAAGG - Intronic
1105913182 13:24890392-24890414 CTGTGAGCGTGGTCAGGGGTGGG - Intronic
1106114831 13:26808405-26808427 CTCTGAGGGTGGAAAGGAGATGG - Intergenic
1106365417 13:29074348-29074370 CTGTGGGAGCACACAGGAGAGGG - Intronic
1108526936 13:51293471-51293493 CTGTGGGCAAAGAAAGGAGAAGG - Intergenic
1109747696 13:66647926-66647948 CTGTGGGCCTGGGGAAGAGACGG + Intronic
1111900056 13:94189264-94189286 CTTTGGGGGTGGACAGGAGGAGG + Intronic
1116350112 14:43850703-43850725 GTGTGGTGGTGGACAGGAAAAGG - Intergenic
1119192384 14:72691800-72691822 CTGTGCGAGCGGACAGGAGAAGG + Intronic
1119266253 14:73264693-73264715 CTGTGGGTGTGAAGAGGGGATGG - Exonic
1122907008 14:104806221-104806243 GTGTGGGAGTGGGCAGGAGCTGG - Intergenic
1124576857 15:30917047-30917069 ATGTGGGGGTGGACAGGACTGGG + Intronic
1124707014 15:31974609-31974631 CTGGGTGCTTGGAGAGGAGACGG + Intergenic
1124955209 15:34355825-34355847 CCTTGGGTGTGGAGAGGAGAGGG + Exonic
1125356371 15:38820782-38820804 CTTTGGGCTTGGGCAGAAGAGGG + Intergenic
1127341021 15:58044298-58044320 CGGTGGGTGGGGGCAGGAGAGGG - Intronic
1128214000 15:65921950-65921972 CTGTGGGAGTGCAGAGGAGCTGG - Intronic
1128443780 15:67738854-67738876 CTGAAGGTGTGGACAGGAGGAGG - Intronic
1128637506 15:69312619-69312641 CGGGGGGACTGGACAGGAGAAGG - Intronic
1128664942 15:69531113-69531135 CAGTGGGCTTGGGCAGGGGAGGG + Intergenic
1129333864 15:74841065-74841087 CTGTGGGCAGGGACAGGACTTGG - Intronic
1129467426 15:75731808-75731830 ATGTGGGCGTGGAGAGGAAGAGG - Intergenic
1129719840 15:77872041-77872063 CTGTGCACGTGGTCATGAGAGGG - Intergenic
1130048898 15:80467258-80467280 CAGTCGGCATGGACTGGAGAAGG + Intronic
1130115225 15:81000696-81000718 CTGGGGGAGCGGACAGGGGAAGG - Intergenic
1131094571 15:89647358-89647380 GTGTGAGCTTGGACGGGAGAGGG - Intronic
1132600254 16:769945-769967 CTGTGGGAGTGGCCACGAGGCGG + Intronic
1133056411 16:3147589-3147611 CTCTAGGAGAGGACAGGAGAGGG - Intronic
1133395829 16:5446751-5446773 CGGTGGGGATGGACAGGAGGAGG - Intergenic
1133543878 16:6786246-6786268 GTATGGGCCTGGCCAGGAGACGG + Intronic
1134644908 16:15858199-15858221 GTGCGTGCGTGGACAGGAGCGGG - Intergenic
1136012012 16:27369900-27369922 CTGTGGCTGAGGACAGGAGGTGG - Intergenic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1136578063 16:31135773-31135795 CAGTGGGCGGGGCCAGGGGAGGG - Intergenic
1137253371 16:46756480-46756502 CTGGGGACCAGGACAGGAGACGG + Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1140930478 16:79623103-79623125 CTGTGGGAGGGGACAAGAGGTGG - Intergenic
1142428225 16:90011894-90011916 CTGAGGGGGTGCCCAGGAGAGGG + Intronic
1142848752 17:2694390-2694412 CTGTGGCCCTGGCCAGGAGTGGG + Intronic
1143037455 17:4007505-4007527 CTGTGGGGGGGGTCAGAAGAGGG + Intronic
1143163668 17:4886931-4886953 GTGTGGGCCTGGACAGGACCGGG - Intronic
1144799313 17:17914141-17914163 CTCTGGGCGTGGACAGAGGAGGG + Intronic
1145023905 17:19453356-19453378 CTGTGGCTGTGGACAGGAGCTGG + Intergenic
1147251103 17:39152705-39152727 ATATGGGCGGGGACAGGAGAAGG + Intronic
1147598519 17:41732150-41732172 GAGTGGGCAGGGACAGGAGAGGG + Intronic
1148457939 17:47820997-47821019 CTGTGAGGGTAGACAGGGGATGG - Intronic
1148915766 17:50977137-50977159 TTGTGGGTGGGGACAGGAAATGG - Exonic
1150426108 17:65078355-65078377 CTGAGGACCTGGACAGGGGAGGG + Intergenic
1151247683 17:72807666-72807688 CAGTGGGCCTGGAGAGGAAATGG + Intronic
1151425715 17:74029851-74029873 CTGTGGGGGTGGAAAGCAGCTGG + Intergenic
1151857793 17:76735771-76735793 CTGTGGGCGTGTATTGGAGCAGG - Exonic
1151902378 17:77025033-77025055 CTGTGGGAGTTCAGAGGAGAGGG - Intergenic
1152189431 17:78879522-78879544 TCGGGGGCATGGACAGGAGATGG - Intronic
1152427290 17:80225233-80225255 CTGAGGTCCTGGGCAGGAGAAGG - Intronic
1152772111 17:82176500-82176522 CTGTGGGGGTAGACAGGTGAGGG - Intronic
1153168001 18:2283898-2283920 CTTTGGGCGAGGAAGGGAGAAGG - Intergenic
1154145358 18:11862136-11862158 CTGTGGCAGTGGAGAAGAGAGGG + Intronic
1156676495 18:39532591-39532613 CTGTGGGAGTGGTTAGGACAAGG - Intergenic
1160799211 19:960069-960091 CTGTGAGGGTGGAGAGGGGATGG - Intronic
1160939323 19:1612886-1612908 GTGTGGGTGTGGACAGCAGTGGG + Intronic
1160939354 19:1613084-1613106 GTGTGGGTGTGGACAGCAGTGGG + Intronic
1161030146 19:2054238-2054260 CTGTGGGAGAGGACAGGACCTGG - Intergenic
1161470793 19:4455998-4456020 CTGCAGTGGTGGACAGGAGAAGG - Intronic
1161523409 19:4738556-4738578 CAGTGGGCTGGGACAGGAGGTGG + Intergenic
1161857282 19:6773100-6773122 CTCTGGGCCTGCAAAGGAGAGGG + Intronic
1162450635 19:10752338-10752360 CTGTGGGCACAGGCAGGAGAAGG - Intronic
1162526442 19:11209457-11209479 GTGAGGGGGTGGACAGGTGAGGG - Intronic
1162526467 19:11209553-11209575 GTGAGGGGGTGGACAGGTGAGGG - Intronic
1162526512 19:11209729-11209751 GTGAGGGGGTGGACAGGTGAGGG - Intronic
1162526518 19:11209745-11209767 GTGAGGGGGTGGACAGGTGAGGG - Intronic
1162526553 19:11209872-11209894 GTGAGGGGGTGGACAGGTGAGGG - Intronic
1162526559 19:11209888-11209910 TTGAGGGGGTGGACAGGTGAGGG - Intronic
1162526689 19:11210463-11210485 GTGAGGGGGTGGACAGGTGAAGG - Intronic
1162526698 19:11210495-11210517 GTGAGGGGGTGGACAGGTGAGGG - Intronic
1165038913 19:33055014-33055036 CTGTGGCCTTGGAGAGGGGAGGG - Intronic
1165121289 19:33560513-33560535 CTGTGGGGAAGGACAGGAGTGGG - Intergenic
1166665340 19:44676441-44676463 CAGTGGGAGCAGACAGGAGAGGG - Intronic
1166988469 19:46676651-46676673 CTGTGGGTGTTGACGGGAGCAGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167956541 19:53069842-53069864 CTGTGGGTTTGGACACTAGAAGG + Exonic
1168116624 19:54224471-54224493 CTGTGTGTGTGGACAGGCGCTGG + Intronic
1168119607 19:54244254-54244276 CTGTGTGTGTGGACAGGCGCTGG + Intronic
1168121519 19:54254699-54254721 CTTTGAGCTTGGACAGGACAGGG + Intronic
1168168613 19:54572171-54572193 CTGTGTGTGTGGACAGGCGCTGG - Intergenic
1168184981 19:54694893-54694915 CTGTGTGTGTGGACAGGCGCTGG - Intronic
1168575205 19:57503446-57503468 CTGTGGGGATAGACATGAGATGG + Intronic
925613869 2:5726437-5726459 CAGAGGGCGTGGGCAGGAGCTGG + Intergenic
925920628 2:8635365-8635387 CTGTGGGCCTTGACAGAAAAAGG - Intergenic
927784746 2:25965910-25965932 CTGTGGGGGTGGAAAAGACAGGG + Intronic
930033620 2:47072589-47072611 CAGTGGGCGGGCACCGGAGAGGG + Intronic
930347002 2:50196119-50196141 CTGTGGGGGTGGTCAGGGGTAGG - Intronic
934748273 2:96774148-96774170 CTGTGGGAGGGGGCAGGGGAAGG + Intronic
935401446 2:102664551-102664573 GTGTGGGCGGGGAGAGGAGGTGG + Intronic
935998333 2:108798690-108798712 GTGTAGGCGTGGAGAGGAGGAGG - Intronic
936125857 2:109788754-109788776 CTGTGGGGGTGGACAGGTATCGG - Intergenic
936218836 2:110582714-110582736 CTGTGGGGGTGGACAGGTATCGG + Intergenic
936474201 2:112825272-112825294 CTGTGTACCTGGAGAGGAGAAGG - Intergenic
936662734 2:114560209-114560231 CTGTGGGAGTTGGGAGGAGAAGG + Intronic
937318505 2:120947144-120947166 CTCAGGGTGTGGACAGGATAAGG - Intronic
937590799 2:123611079-123611101 CTGGGCGACTGGACAGGAGAAGG - Intergenic
937846187 2:126581739-126581761 CTGTTGGCGGGGTCAGGGGAGGG + Intergenic
937907464 2:127059156-127059178 CTGTGGGGGAGGACAAGAAAGGG + Intronic
938138680 2:128779555-128779577 CTGTGGCTGGGGGCAGGAGAGGG + Intergenic
939866677 2:147480904-147480926 CTGTGGGAGTTCACAAGAGAGGG + Intergenic
941481654 2:166023327-166023349 CTGTGGCCTGGGCCAGGAGAAGG - Intronic
942613062 2:177762091-177762113 CTGTGAGGATGGACAGGAGCAGG + Intronic
944663205 2:201938306-201938328 GGGTGGGGGTGGACAGGACATGG - Intergenic
944866783 2:203870432-203870454 CTGGGGGTGTGGAGAGGGGAAGG + Intronic
945038397 2:205723986-205724008 CTGTGAGGGTGTACAGGTGAAGG + Intronic
945980411 2:216305643-216305665 CTGTGGGTGTGAACAGGTGCTGG - Intronic
946537377 2:220646525-220646547 GAGTGGGGGTGGTCAGGAGAAGG + Intergenic
947204875 2:227651287-227651309 CTGTGGCCGTGGAAGAGAGAAGG + Intergenic
947859559 2:233348972-233348994 CTGTGGCAGAGGACAGGGGAAGG - Intergenic
948768102 2:240233662-240233684 CTGTGGGCGGGGTCAGAGGAGGG - Intergenic
948806577 2:240455799-240455821 TTGTGGTCCTGGACATGAGATGG - Intronic
949052550 2:241904899-241904921 CTGTGGGTGTTGTCAGGAGGTGG + Intergenic
1168831409 20:847054-847076 CGGTGGGCGTGGAGAGGGGGTGG + Intronic
1168878046 20:1184941-1184963 CTGTGGGCAAGGGCAGGAGCAGG - Intronic
1171422249 20:25025051-25025073 CTATGGGCGAGGAAGGGAGATGG + Intronic
1172808391 20:37629858-37629880 CTGTGCGCGTGTATAGCAGAGGG + Intergenic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173666919 20:44769657-44769679 CCGTGGGCGAGAACAGGAGGAGG - Intronic
1173779041 20:45738004-45738026 CTGTGGGGCTGAACAGGAGAGGG - Intergenic
1175159790 20:56999747-56999769 CTGTGGGAGGGGACAGAACATGG - Intergenic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176142116 20:63549297-63549319 CGGTGGGTGTGGGGAGGAGACGG - Intronic
1176311886 21:5154890-5154912 GTGTGGGCGGGGCCCGGAGAAGG - Intergenic
1176367757 21:6044122-6044144 CTGTGGGCGGAGACGGGGGAGGG - Intergenic
1177789885 21:25711390-25711412 CTATGGGCGTAGAGAGAAGATGG + Intronic
1179179590 21:39034409-39034431 CCGGAGGCGGGGACAGGAGAGGG - Intergenic
1179666315 21:42915134-42915156 TTGTGGGCGGGGACAACAGAAGG - Intergenic
1179755762 21:43494420-43494442 CTGTGGGCGGAGACGGGGGAGGG + Intergenic
1179845161 21:44107141-44107163 GTGTGGGCGGGGCCCGGAGAAGG + Intergenic
1179885016 21:44310148-44310170 CTAAGGGTGTGGAGAGGAGAAGG - Intronic
1180057172 21:45364998-45365020 CTGTGGGCGGGAAGAGCAGATGG + Intergenic
1180229600 21:46418974-46418996 CAGTGGGCGTGAGCATGAGAGGG - Intronic
1180717906 22:17884377-17884399 GTGTGGGTGGGGACAGGACATGG + Intronic
1180956342 22:19743065-19743087 TTGGGGGCGAGGAGAGGAGAGGG + Intergenic
1181397532 22:22632719-22632741 CCTTGGGGGTGGACAGGAGGTGG + Intergenic
1181565732 22:23736144-23736166 CTGTGGGGGAAGACAGGAGAGGG - Intergenic
1181570739 22:23766773-23766795 CTTTGGGCGGGTGCAGGAGAGGG + Intronic
1181651874 22:24263339-24263361 CCTTGGGGGTGGACAGGAGGTGG - Intergenic
1181705503 22:24647400-24647422 CCTTGGGGGTGGACAGGAGGTGG + Intergenic
1182011650 22:27006297-27006319 CTGTGAGCAAGGACAGCAGAGGG - Intergenic
1182095638 22:27623455-27623477 ATGTGGGCGTGGAGAGGCCAGGG + Intergenic
1183192864 22:36332832-36332854 CTGTGGGTGGGGCCAGGAGGGGG + Intronic
1183196746 22:36358691-36358713 CTGTGGGCCTGGACTGGAACAGG - Intronic
1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG + Intronic
1183299896 22:37053712-37053734 CTGTGGGTGGAGGCAGGAGAGGG + Intronic
1183729572 22:39610374-39610396 GGGTGGGCGTGGACTGGGGAAGG + Intronic
1183948296 22:41339032-41339054 TCGTGGGCGTGGAGGGGAGAAGG - Exonic
1184212580 22:43044632-43044654 GAGTGGGCGTGGAGAAGAGAGGG - Intronic
1184825173 22:46945678-46945700 CTGTGGGCCTGTACAGGAGCAGG + Intronic
1185139555 22:49092701-49092723 CTGTGGGCGGGAAGAGGGGAAGG - Intergenic
1185210451 22:49567976-49567998 CTGTGGCCGTGGAAAGCTGAAGG + Intronic
1185318687 22:50190394-50190416 CTGTGGCCATGGACAGGGCAGGG - Intronic
1185413293 22:50697173-50697195 CAGTGGGCGTGGGCAGGGGCCGG + Intergenic
1203275647 22_KI270734v1_random:84124-84146 CCTTGGGGGTGGACAGGAGGTGG - Intergenic
950040085 3:9914751-9914773 CTGTGGGCGCCGGCAGGTGAGGG - Exonic
952973339 3:38671236-38671258 TGGTGGTAGTGGACAGGAGAGGG + Intergenic
953253236 3:41265184-41265206 CTGTGGCCGTGGATCTGAGATGG - Intronic
953758025 3:45664703-45664725 CTGTGGGCGTCACCAGGCGAGGG + Intronic
954132804 3:48568856-48568878 CTGTGGGAGTGACCAGGAGAGGG + Intronic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954659806 3:52221037-52221059 CTGGAGGCATGGACAGGAGGAGG - Intergenic
957041393 3:75338164-75338186 CGGTGAGTGTGGACAGGGGAGGG + Intergenic
957619803 3:82581080-82581102 ATGTGTGTGTGGACAGGTGAGGG - Intergenic
959946704 3:112133054-112133076 CTGTGGGAGAGCAGAGGAGATGG - Intronic
961566629 3:127768715-127768737 CTGGAGGGGTGGACAGGACAGGG - Intronic
961601388 3:128064911-128064933 CTGTGCGTGTGGCCAGCAGATGG - Exonic
962847274 3:139283584-139283606 CTGGTGGAGTGGACAGGAGCTGG + Intronic
965295103 3:166935369-166935391 CTGTGGGGGTGGTTAGGGGAGGG - Intergenic
966876285 3:184323711-184323733 CTGTTGGGAGGGACAGGAGAGGG - Intronic
968384747 4:125757-125779 CAGTGGGCGTGCTCAGGAGTGGG - Intronic
968393750 4:213895-213917 CAGTGGGCGTGCTCAGGAGCGGG - Intergenic
969184208 4:5463435-5463457 GTGTGGGTGTGTGCAGGAGAGGG - Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969478599 4:7434979-7435001 CTGTGGGAGTGGCCAGGAGGTGG - Intronic
969659511 4:8518231-8518253 CTTCTGGCGTGGACAAGAGAGGG + Intergenic
970254735 4:14155567-14155589 CAGTGGGCGTTGAGAGGAGGTGG + Intergenic
971358288 4:25914099-25914121 CTGGGGGCGGGGCCAGGAAAGGG - Intronic
971452004 4:26809324-26809346 CTGAGGGACTGGACAAGAGAGGG + Intergenic
971944872 4:33261392-33261414 CTGTGGTTGTGGGCAGTAGAAGG - Intergenic
977591480 4:98832203-98832225 CTGGGGGCGTGGACAGAAGGAGG + Intergenic
978503737 4:109434427-109434449 CTGAGTGCGTGGTCCGGAGAAGG + Intronic
983531346 4:168812883-168812905 ATGTGGGCGTGGAAATTAGAGGG + Intronic
984748855 4:183252575-183252597 ATGTGGACAGGGACAGGAGAAGG - Intronic
985485628 5:146668-146690 CTGTGGGGGAGGAGAGGAGGGGG - Intronic
985538771 5:478348-478370 CTCTGGGCGGGCACAGGCGAGGG + Intronic
985750044 5:1668353-1668375 CTGGGGGCGAGGGCAGGACAGGG + Intergenic
993148331 5:84125924-84125946 ATGTGGGGGTGAACAGGTGATGG + Intronic
994052171 5:95374690-95374712 CTGTGGGCATTGACAGGGAAGGG - Intergenic
994806482 5:104453805-104453827 ATATGAGCATGGACAGGAGAGGG - Intergenic
995846878 5:116502938-116502960 ATGTGGGCTTTGACAGGACAGGG + Intronic
997583096 5:135029322-135029344 CTGGGGGAGGGGACGGGAGAAGG + Intronic
997606169 5:135177137-135177159 CTGTGAGGGTGCACAGGAGGTGG + Intronic
997953928 5:138263953-138263975 CAGCGGGTATGGACAGGAGATGG - Intronic
998415703 5:141944856-141944878 CACTGGGCCTGGACAGGAGTGGG - Exonic
1000064714 5:157684566-157684588 CTGTGGCCCTGGAGAGGAGGAGG - Intergenic
1001678909 5:173541718-173541740 GTGTGGGCATGGCCAGGAGCAGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1003572036 6:7262131-7262153 CTGTGGGCGTGGTCACCACAGGG - Intergenic
1003860486 6:10318214-10318236 GTGAGGGGGTGGACAGGTGAAGG - Intergenic
1004204081 6:13574959-13574981 CAGTGGGCGTGGAGAGGGGTCGG + Intronic
1005790113 6:29291176-29291198 CTGTGAGAGTGGACTGGACAAGG - Intergenic
1005928112 6:30461475-30461497 CTGGGTGGGTGGACAGCAGAGGG + Intergenic
1006582130 6:35083255-35083277 CTGTGGGACTGGCCAGCAGAAGG + Intronic
1008665015 6:53707348-53707370 CAGTGGGCCTGGTCAAGAGACGG - Intergenic
1008673536 6:53795984-53796006 CTGCGGGGGTGGACGCGAGATGG + Intronic
1008838672 6:55869956-55869978 GTGTGGGAGTGGTAAGGAGAGGG + Intronic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1012231291 6:96763217-96763239 CTGTGGCCTTGGCCAGGAGAAGG - Intergenic
1013006910 6:106082264-106082286 CTGTGGGAAAGAACAGGAGAAGG - Intergenic
1013537332 6:111075204-111075226 CTCTACACGTGGACAGGAGAAGG + Intergenic
1013538717 6:111087431-111087453 CTGGGGGCGTGGCCGGGAGCGGG - Intergenic
1014384949 6:120788668-120788690 GTGTGTGTGTGGGCAGGAGAGGG - Intergenic
1015647087 6:135404177-135404199 TTTTGGGAGTGGACAGAAGAGGG + Intronic
1016523032 6:144967965-144967987 CTGTGGGCCAGGCCAGGAGGTGG - Intergenic
1016853973 6:148648009-148648031 CTATGGGTGTTCACAGGAGATGG + Intergenic
1018537472 6:164836701-164836723 CTGGAGGCATGGACAGGAGGTGG - Intergenic
1018870887 6:167781273-167781295 GTGTGGGAGTGGACAGGCGGAGG - Intergenic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019432993 7:1007957-1007979 TTGGGGACGTGGGCAGGAGAGGG - Intronic
1019542955 7:1559708-1559730 CCGTGCCCGTGGACAGGAGCCGG - Intronic
1019844127 7:3479988-3480010 CTTTGGGCGTGGACAGGTGAGGG - Intronic
1020025887 7:4899752-4899774 CTGTGGGAGTAAACAGAAGACGG + Intergenic
1021811533 7:24406437-24406459 GTGTGGGCGTGTACAGGAAGGGG - Intergenic
1022404824 7:30078892-30078914 CTGGGGGGATGGACAGGAGGTGG + Exonic
1022405872 7:30089341-30089363 CTGTGGGGGTGGTCTGGAGTGGG - Intronic
1023062626 7:36343324-36343346 CTGTAGGAGAGGAGAGGAGAGGG + Intronic
1023570331 7:41565310-41565332 CTGTGGGAAACGACAGGAGAGGG - Intergenic
1024527150 7:50358408-50358430 CTGTGGGACGGGGCAGGAGAGGG + Intronic
1025936677 7:66043735-66043757 GTGTGGGTGTGTACAGGCGAGGG - Intergenic
1025940400 7:66072739-66072761 CTGTGGGAGAAGACAGGAGAGGG + Intergenic
1026773107 7:73214401-73214423 CTGTGGGCTGGCCCAGGAGACGG + Intergenic
1026837106 7:73646773-73646795 CTGAGGGCCTGGGCAGGACATGG + Intergenic
1026941438 7:74289884-74289906 CGGTGGGCGTGGGCGGGAGCTGG + Intronic
1027013969 7:74767797-74767819 CTGTGGGCTGGCCCAGGAGACGG + Intergenic
1027074068 7:75178235-75178257 CTGTGGGCTGGCCCAGGAGACGG - Intergenic
1029316845 7:99723619-99723641 GTGAGGGCGAGGACAGGGGATGG - Intronic
1029662043 7:101968862-101968884 CTGTGGCCTTGGGCAGGACACGG + Intronic
1029730045 7:102433254-102433276 CTGGGGCCGGGGACAGGAGCTGG + Intronic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1030927638 7:115477572-115477594 CAGCGGGCGTGGACAGGGAAGGG + Intergenic
1033406423 7:141074199-141074221 CTGGGGGAGGGGGCAGGAGAGGG - Intergenic
1033735452 7:144217415-144217437 CTGTGGCAGTGGAGAGGATATGG + Intergenic
1033747602 7:144333554-144333576 CTGTGGCAGTGGAGAGGATATGG - Intergenic
1034151986 7:148924253-148924275 CAGAGGGCCTGGTCAGGAGATGG - Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035959282 8:4119089-4119111 CAGTGGGTGGGGACAAGAGAAGG + Intronic
1036132527 8:6128996-6129018 CAGAGGACGTGGGCAGGAGATGG + Intergenic
1036772701 8:11590029-11590051 CTGAGGCCGTGGACAGGCGTGGG + Intergenic
1036990248 8:13584325-13584347 CTGTGGGCCTGGACAGGGGTGGG + Intergenic
1037818145 8:22122613-22122635 GGGTGGGGGTGGGCAGGAGAGGG + Intronic
1039573662 8:38606278-38606300 CATTGGGCATGGGCAGGAGAGGG - Intergenic
1039588094 8:38723712-38723734 CTGGGGGCGTGGGGAGCAGAGGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045556407 8:103218790-103218812 CTGGGGGAGGGGACAGGAGGAGG - Intronic
1045652279 8:104352418-104352440 CTTTGGGGGTGGCCAGGAAAAGG + Intronic
1046856736 8:119040786-119040808 CTGTGGCCATTGACAGGGGAAGG + Intronic
1047257874 8:123229473-123229495 CTGTTGGCGTGGCCAAAAGAAGG - Intronic
1048484278 8:134832434-134832456 CAGTGGGCGGGGACAGGAAATGG - Intergenic
1049357983 8:142198232-142198254 CTGGGGGCGGGGTCTGGAGAGGG - Intergenic
1049425376 8:142535734-142535756 CTGTGGGCGAGCAGAGGAGCTGG - Intronic
1049431766 8:142568642-142568664 TTGTGGGTGTGGAAAGGAGGCGG - Intergenic
1049483426 8:142838982-142839004 CTCTGGGCATTGACAGTAGAAGG + Intronic
1052079021 9:24180286-24180308 CTGTGAAAGTGGCCAGGAGAGGG - Intergenic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1053494184 9:38537731-38537753 CTGGGTGCAAGGACAGGAGAAGG + Intergenic
1053559184 9:39171598-39171620 CTGTGGCTGTGGACATGAGAAGG + Exonic
1053823302 9:41991839-41991861 CTGTGGCTGTGGACATGAGAAGG + Exonic
1054137927 9:61447348-61447370 CTGTGGCTGTGGACATGAGAAGG - Intergenic
1054607271 9:67195526-67195548 CTGTGGCTGTGGACATGAGAAGG - Intergenic
1054903226 9:70391173-70391195 CTGTGGGCTAGGACTGGAAAAGG + Intronic
1056552014 9:87660005-87660027 CTGAGGGCGTGGACAGGGGCTGG + Intronic
1056764357 9:89435774-89435796 CTGTGGGCGTGGCCCTGGGAGGG - Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1057819744 9:98321885-98321907 CTGTGGCCCTGGGCAGGGGAAGG - Intronic
1061182435 9:129032712-129032734 CTCTGGGCGTGGGCAGAAGGAGG - Intergenic
1061677685 9:132227688-132227710 GGCTGGGCGAGGACAGGAGAGGG - Intronic
1062326652 9:136015572-136015594 CTTTGGGGGTGGACAGGAACAGG + Intronic
1062599251 9:137312587-137312609 CCTTGGGCCTGGAGAGGAGAGGG - Intronic
1189740915 X:44116432-44116454 TTGTGTGTGTTGACAGGAGAGGG - Intergenic
1189957391 X:46289139-46289161 CAGTGGGTGTGGACTGGTGATGG + Intergenic
1190245085 X:48685663-48685685 CTTGGGGTGTGGAGAGGAGATGG + Intronic
1192083990 X:68077002-68077024 GTGTGGGAGTGGCCTGGAGAGGG + Intronic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1198968164 X:142249973-142249995 GCCTGGGCGTGGAGAGGAGAGGG + Intergenic
1199610224 X:149606513-149606535 CTGTGGGAGTTGAGAAGAGAGGG - Intronic
1199792316 X:151166915-151166937 CACTGGGAGTGGACACGAGAGGG + Intergenic