ID: 1183238935

View in Genome Browser
Species Human (GRCh38)
Location 22:36641246-36641268
Sequence CCTTCCCCTCGTGGGCTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 6, 3: 39, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183238935_1183238939 2 Left 1183238935 22:36641246-36641268 CCGCAGAGCCCACGAGGGGAAGG 0: 1
1: 0
2: 6
3: 39
4: 284
Right 1183238939 22:36641271-36641293 TTTATCTTTTTGATCTCTGCTGG 0: 1
1: 1
2: 7
3: 112
4: 706
1183238935_1183238941 29 Left 1183238935 22:36641246-36641268 CCGCAGAGCCCACGAGGGGAAGG 0: 1
1: 0
2: 6
3: 39
4: 284
Right 1183238941 22:36641298-36641320 CCAGTACCTAGCACAGTGCCTGG 0: 5
1: 86
2: 537
3: 1851
4: 4932

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183238935 Original CRISPR CCTTCCCCTCGTGGGCTCTG CGG (reversed) Intronic
900101993 1:965941-965963 CCGCCACATCGTGGGCTCTGGGG + Intergenic
900165722 1:1243601-1243623 CCTTCCCCAGGCGGGGTCTGTGG - Intronic
900249683 1:1661290-1661312 CCCCCTCCTCGTGGGCTCTGGGG - Intronic
900260720 1:1727197-1727219 CCCCCTCCTCGTGGGCTCTGGGG - Intronic
900380149 1:2379950-2379972 GCTTCCCCTCCTGGGTCCTGTGG - Intronic
901249384 1:7763480-7763502 CCTTAACCTCGTGGTCTGTGAGG + Intronic
901627753 1:10633364-10633386 CCCTTCCCTCCTGGGGTCTGGGG - Intergenic
902104583 1:14023748-14023770 ACTTCCCCTCCTGGCATCTGAGG - Intergenic
902335308 1:15751155-15751177 CCTCTCCCTGGTGGGCTCTGAGG - Intergenic
902512683 1:16974876-16974898 CCTGGCCCTCCTGGGATCTGGGG - Exonic
904322223 1:29705377-29705399 CCTTCCCCTCCTGGACACTGTGG - Intergenic
905529277 1:38663890-38663912 CCTTTCTCTCGTGGGCTCTTTGG + Intergenic
905535036 1:38714607-38714629 CCTTCCCCTTGTGATCTTTGAGG - Intergenic
907310575 1:53536792-53536814 CCTTCCCAGCGTCAGCTCTGGGG - Intronic
908117533 1:60954457-60954479 CATTCCCCACGTGCGTTCTGGGG - Intronic
910396493 1:86799316-86799338 CCTTCCCATCTTGGTCTCTTTGG - Intergenic
910908709 1:92211003-92211025 ACTTTCCCTCGTAGGCACTGTGG - Intergenic
910963318 1:92784605-92784627 CCTCCTTCTCGTGGGCGCTGGGG - Intronic
912262404 1:108122546-108122568 CCTTCCCCTGGTGACCTCCGAGG + Intergenic
912273032 1:108229484-108229506 CATTCCTCTCCTGTGCTCTGAGG - Intronic
914361448 1:146939185-146939207 CCCTCCTCTCGTGGGCGCTGGGG + Intronic
914491157 1:148151525-148151547 CCCTCCTCTCGTGGGCGCTGGGG - Intronic
918839274 1:189513434-189513456 CGTTCCCCTGGATGGCTCTGAGG + Intergenic
920651490 1:207840558-207840580 GCTGCCCCTGGTGGCCTCTGTGG - Intergenic
921707684 1:218343080-218343102 TCTTACCCTCCTGGGCTTTGGGG + Intergenic
922161283 1:223080633-223080655 CCTTCCCCCCCAGGGCTGTGAGG - Intergenic
922339116 1:224641365-224641387 CCTTCCCCACCTGGACTCTTTGG + Intronic
922611222 1:226930344-226930366 CCTCCACCTCTTGGGCTCTTGGG + Intronic
922768979 1:228171695-228171717 CCTTGCCCTGTAGGGCTCTGCGG + Intronic
922798329 1:228352569-228352591 CCTTCACCTCCTGGGCTCAAGGG - Intronic
922912479 1:229229381-229229403 CCTTACCCTCTTTGTCTCTGTGG - Intergenic
923722914 1:236482559-236482581 CCTTCTCCACGTCGGCCCTGTGG - Exonic
924535124 1:244929035-244929057 CCTTCACCTCCTGGGCTCAAGGG + Intergenic
924744297 1:246818202-246818224 CCTGGCCCTCCTGGGATCTGGGG + Intergenic
1063086465 10:2822606-2822628 CCTTCTGCTCCTGTGCTCTGTGG + Intergenic
1063186988 10:3660547-3660569 CCTCCCTCTCCTGGGCTCTCTGG - Intergenic
1064005066 10:11692836-11692858 CCTTTCCTCTGTGGGCTCTGTGG + Intergenic
1066441808 10:35446745-35446767 CTTGCCCCTTGTGGGATCTGTGG + Intronic
1067337019 10:45374348-45374370 CCTCAGCCTCGTGGGCTCGGCGG + Exonic
1067793920 10:49307242-49307264 GCTTCTCCTCGTGAGCTCAGAGG - Intronic
1067796779 10:49326758-49326780 CCCTCCTCTCCTGGGCTCTGGGG - Exonic
1068767892 10:60784544-60784566 CCTCCTCCTCCTGGGCTCAGGGG - Intronic
1069258282 10:66361619-66361641 CCTTCACCTCCTGGGCTCAAGGG + Intronic
1071278170 10:84075555-84075577 CCTTCACCTTGCGGGCTTTGTGG - Intergenic
1071813540 10:89208348-89208370 CCTTCCCCTTGTTGGCTTTGCGG + Intergenic
1072032743 10:91537035-91537057 TCCTCCCTTCTTGGGCTCTGTGG - Intergenic
1074065350 10:110008175-110008197 CCCTACCCTCTGGGGCTCTGCGG + Exonic
1075334286 10:121597626-121597648 CCTTCCGCCCGTCTGCTCTGGGG + Intronic
1076241481 10:128911611-128911633 CCTTGACCTCCTGGGCTCAGGGG + Intergenic
1076715523 10:132362032-132362054 CCTTCCCCTCATGGGGTGTTGGG + Intronic
1076725106 10:132409510-132409532 CCTTCCCCTCTCAGGCTCGGTGG - Intronic
1076786112 10:132750952-132750974 GTTTCCCCTCGTGGGGTTTGGGG + Intronic
1076822398 10:132945927-132945949 CCCTCCCCTAGTGGGCTCTGGGG - Intergenic
1076854687 10:133110083-133110105 CTTTTCCCTCGTTGGCCCTGTGG - Intronic
1077059275 11:610602-610624 CCTGCCGCTAGTGGGCTGTGGGG + Exonic
1077338943 11:2017550-2017572 CCATACCCCCGTGGGGTCTGGGG + Intergenic
1077714905 11:4570773-4570795 CCTTCCCCTAGGGGGATCTATGG + Intergenic
1078341514 11:10500886-10500908 CTTTCCCCTGCTGGGCCCTGGGG + Intronic
1078533732 11:12156710-12156732 CCTGCCCATGGTGGGCTCTGTGG + Intronic
1079340475 11:19607376-19607398 CCTTGCCATCATGAGCTCTGGGG + Intronic
1081672203 11:44948800-44948822 CCTGCCCCTCTTGGGGTATGGGG - Intronic
1083275613 11:61595447-61595469 CCCTACACTAGTGGGCTCTGGGG - Intergenic
1085068639 11:73521431-73521453 CCTTCCACCCTTGGGCTCAGTGG - Intronic
1085317715 11:75555453-75555475 CCCTCCCATGGTGGCCTCTGTGG + Intergenic
1086114205 11:83230133-83230155 CCTTGACCTCCTGGGCTCAGGGG + Intronic
1088735202 11:112723058-112723080 CCTTGCCTGCCTGGGCTCTGAGG - Intergenic
1089417303 11:118302804-118302826 CCTCCCCCTCCTGGGCTCAAGGG - Intergenic
1089633130 11:119795928-119795950 TCCTCCCCTCATGAGCTCTGAGG + Intergenic
1089821130 11:121227060-121227082 CCTTCCCATCATGGGCCCAGAGG - Intergenic
1090253167 11:125264904-125264926 ACTTCCCAGAGTGGGCTCTGGGG + Intronic
1090941533 11:131392246-131392268 CCATCCCTTCAGGGGCTCTGTGG - Intronic
1090941542 11:131392284-131392306 CCATCCCTTCAGGGGCTCTGTGG - Intronic
1090941550 11:131392322-131392344 CCATCCCTTCAGGGGCTCTGTGG - Intronic
1090941559 11:131392360-131392382 CCATCCCTTCAGGGGCTCTGTGG - Intronic
1090941577 11:131392436-131392458 CCATCCCTTCAGGGGCTCTGTGG - Intronic
1091239081 11:134040478-134040500 CCTTCCCCTCCTTGGCTCCTTGG - Intergenic
1202821927 11_KI270721v1_random:72732-72754 CCATACCCCCGTGGGGTCTGGGG + Intergenic
1095444730 12:42272412-42272434 CCTACCCCTCCTGGGTTCAGGGG + Intronic
1096990868 12:55801699-55801721 CCTCCCCCTCCTGGGCTCAAGGG + Intronic
1101413201 12:104486083-104486105 CCTTCCCTGCCTGGGCTTTGGGG + Intronic
1102030960 12:109739872-109739894 CCTCCTCCTCGTGGCCTCTGTGG - Intronic
1102229494 12:111252709-111252731 CCAGCCCCGCCTGGGCTCTGAGG + Intronic
1102684005 12:114710213-114710235 CCTGCCTCCCGTGAGCTCTGAGG - Intergenic
1102776377 12:115523168-115523190 CCTTGACCACCTGGGCTCTGGGG - Intergenic
1102938224 12:116915170-116915192 CCTTAGCCCTGTGGGCTCTGGGG - Intronic
1104479047 12:129091428-129091450 CTATCCTCTCCTGGGCTCTGGGG + Intronic
1104671448 12:130683316-130683338 CCTTCCCCCTGGAGGCTCTGTGG - Intronic
1104886893 12:132115685-132115707 CCGTGCCCTCGCTGGCTCTGGGG + Intronic
1105859208 13:24394773-24394795 CCTTGCCCTCATGGGCTGGGAGG + Intergenic
1106673002 13:31927490-31927512 CCTTCCCCTAAGTGGCTCTGGGG - Intergenic
1107162463 13:37247149-37247171 CATTGCCCTCGTGGGACCTGGGG + Intergenic
1108145299 13:47470606-47470628 CCCTCCCTTCCTGGGCTCAGAGG - Intergenic
1109538000 13:63741180-63741202 TCTTCCCCCCCTGGGCTCTTAGG - Intergenic
1113949881 13:114066028-114066050 CCCTCGGCTCATGGGCTCTGTGG + Intronic
1114439543 14:22735042-22735064 CCTGCTCCTCCTGGGCTCTTAGG + Intergenic
1115608119 14:35025970-35025992 CCTTGCCCTCCTGGGCTCATGGG - Intronic
1117591077 14:57268783-57268805 CCCGCCCCTCCTGGGATCTGTGG - Exonic
1118449441 14:65886580-65886602 CCTTGGCCTCCTGGGCTCAGTGG + Intergenic
1119342031 14:73887102-73887124 CCTTCCCCTCGCGGGTTTTTAGG + Intronic
1121317125 14:92968928-92968950 CCTTCCCAGCATGTGCTCTGTGG - Intronic
1121790119 14:96692890-96692912 CCTGCCCATCGGGGGCTCAGAGG - Intergenic
1122083918 14:99286248-99286270 CCCTGCCCTCGGGGGCTCAGGGG + Intergenic
1122354050 14:101112839-101112861 CCCTGCCTTGGTGGGCTCTGGGG + Intergenic
1122606521 14:102950317-102950339 GCTTACCCTCCTGGGCACTGAGG - Intronic
1122632717 14:103114286-103114308 CCATCCTCTCCTGGGCCCTGGGG + Intergenic
1122946678 14:105014185-105014207 CCTTCTGCTCCTGGGCTGTGGGG + Intronic
1202899394 14_GL000194v1_random:26809-26831 CCTTCCCCTCATGGGCTTTCTGG + Intergenic
1127108797 15:55645896-55645918 CCTTCCCTTTCTGGGCTTTGAGG - Intronic
1127959595 15:63880905-63880927 CCTTGACCTCGTGGGCTCTTGGG + Intergenic
1129377812 15:75145255-75145277 CCTTCCCCCTGCAGGCTCTGAGG - Intergenic
1129411871 15:75354771-75354793 CCTCCCCTTCTTGGGCACTGTGG - Exonic
1130952875 15:88605912-88605934 CCTCCTCCGCGTGGGGTCTGAGG - Intergenic
1131179686 15:90231301-90231323 CCCTTCCCACGTGGGCTTTGTGG - Intronic
1131394721 15:92077317-92077339 CCTTCCCTTCTTGGGCTTTTCGG + Intronic
1132668657 16:1093947-1093969 CCTGCCCCTTCTGGCCTCTGCGG + Exonic
1133246206 16:4450535-4450557 CCATACCCTGGGGGGCTCTGAGG - Intronic
1133246761 16:4454362-4454384 CCTCCCGCTTGTTGGCTCTGTGG + Intronic
1134114671 16:11539050-11539072 CCTTCCACCGGTGGGCCCTGGGG - Intergenic
1135114635 16:19714402-19714424 CCTTCCCATTGTGTTCTCTGGGG + Exonic
1135660070 16:24288599-24288621 CCTTCATCTTCTGGGCTCTGTGG + Intronic
1137261423 16:46832918-46832940 CCTTGACCTCCTGGGCTCAGTGG - Intergenic
1137340141 16:47593354-47593376 CCTTGCCCTCCTGGGCTCAAGGG - Intronic
1140456383 16:75107927-75107949 CCTTTCCCTCCTGGGCTGAGGGG - Exonic
1141425205 16:83940373-83940395 CCTTGTCCTGCTGGGCTCTGGGG + Intronic
1142143592 16:88483329-88483351 CCTCCTCCCCGTGGCCTCTGAGG + Intronic
1142146507 16:88495064-88495086 CCGTCCCATCGTGGGATGTGGGG + Intronic
1142303234 16:89270944-89270966 CCTTCCCGTAGCGGTCTCTGGGG - Intronic
1142687020 17:1583236-1583258 CCTGCTGCTCGTGGGCTTTGGGG - Exonic
1143161028 17:4871272-4871294 CCTTCCGCTCCTGGGCTCAAGGG + Intronic
1143914018 17:10275687-10275709 CCTCCACCACGTTGGCTCTGGGG - Intergenic
1145980384 17:29007637-29007659 CCCTCTTCTTGTGGGCTCTGGGG + Intronic
1147969656 17:44212572-44212594 CCTTCCCCTCCTGGCCTGTGGGG - Intronic
1148035376 17:44656250-44656272 CCTTCCTCTCCTTGTCTCTGGGG + Intergenic
1148572865 17:48684607-48684629 CATTCCCCCAGTGGGGTCTGGGG - Intergenic
1151490638 17:74430883-74430905 CCTCCCCCTCGCGGGCGCTCAGG + Intronic
1151638074 17:75366726-75366748 CCTCCACCTCCTGGGCTCAGAGG - Intronic
1151708521 17:75785549-75785571 CGTTTCCCTCGCGGGCTGTGCGG + Intronic
1153436911 18:5077723-5077745 CCTTCACCTCTTGGGCTCAAGGG - Intergenic
1154196278 18:12269779-12269801 CCTTCACCTCCTGGGCTCAAGGG + Intronic
1155205568 18:23555192-23555214 CCTACCCCTCGCCGCCTCTGTGG - Intronic
1155977919 18:32151780-32151802 CCATTCCCTCCTGGCCTCTGTGG + Intronic
1156033512 18:32741176-32741198 CAGTCCCCTCGTGGGCACAGTGG - Intronic
1158388925 18:57027165-57027187 CCTTCCCGTCATGGGCCATGAGG - Exonic
1158598804 18:58839418-58839440 CCTTGACCTCCTGGGCTCAGGGG + Intergenic
1160083661 18:75754174-75754196 CCTTCCCCTCACAGGCTCAGAGG - Intergenic
1160932472 19:1577194-1577216 CCTGCCCCGAGTGGACTCTGCGG - Exonic
1161596446 19:5153368-5153390 CCATCCCCTGGTGGGCTCCTGGG + Exonic
1163679083 19:18670210-18670232 CTTTCCCTTCAAGGGCTCTGTGG + Exonic
1163686507 19:18714878-18714900 CCTGCCCCCACTGGGCTCTGGGG + Intronic
1165185833 19:34020252-34020274 CCTTCGCCTCATGGGCTCAAGGG - Intergenic
1166970381 19:46563169-46563191 CTTTCCTCTTGAGGGCTCTGGGG + Intronic
1167898678 19:52601868-52601890 CCTTCCCAACGCGGGCTCAGGGG - Intronic
1168003648 19:53468293-53468315 CCTCCCCAACGTGGGCTCAGGGG - Intronic
1168145359 19:54417002-54417024 CCTTGCCCTCCTCGGCTGTGGGG - Intronic
1202648060 1_KI270706v1_random:158831-158853 CCTTCCCCTCGTGGGCTTTCTGG - Intergenic
925425453 2:3745791-3745813 CCTTGACCTCCTGGGCTCAGAGG + Intronic
926075607 2:9940698-9940720 CCCTACCCCCGGGGGCTCTGGGG - Intergenic
927216932 2:20672687-20672709 CCTTCCCCTCATCGGCTCCCTGG + Exonic
929105301 2:38359392-38359414 CCTCCCTCTCCCGGGCTCTGGGG - Intronic
929518166 2:42623389-42623411 CCTTCCCCTCCTGGACTCCCTGG + Intronic
930263753 2:49176339-49176361 CCTTCCCCTTTTGGGCTCTGGGG - Intergenic
930716249 2:54596465-54596487 CCTGCCCCTCGTGTGTTATGAGG + Intronic
931164576 2:59733109-59733131 CCTTCCCCTCCCCAGCTCTGAGG - Intergenic
931778094 2:65556983-65557005 GCTTCCACCCATGGGCTCTGGGG - Intergenic
932423249 2:71613516-71613538 ACATCCCCTTCTGGGCTCTGCGG + Intronic
932436446 2:71704927-71704949 CTTTCCCCTCCTGGTCCCTGAGG - Intergenic
934602291 2:95666824-95666846 GCTTCCCCTAGTGGACTCTCAGG - Intergenic
935276623 2:101480903-101480925 GCTTCCTCCCGTGGGCTCTGTGG - Intergenic
936372973 2:111918477-111918499 CTTTCCCCTCTGGGGGTCTGGGG - Intronic
936535653 2:113308978-113309000 GCTTCCCCTAGTGGACTCTCAGG - Intergenic
938067973 2:128292185-128292207 CCTTCACCAGGTGGTCTCTGTGG - Intronic
938248905 2:129798725-129798747 GCTTCCCCTGATGGGCACTGTGG - Intergenic
940702254 2:157060242-157060264 CCTTCCACTCCTAGGCACTGGGG + Intergenic
942671342 2:178379086-178379108 CCTTTCCCTCCTGGGCTCAAGGG - Intronic
944398401 2:199296613-199296635 CCTTTACCTCCTGGGCTCAGGGG - Intronic
946203945 2:218089883-218089905 ACTTCCCCAAGTGGGCGCTGAGG - Exonic
947637046 2:231685478-231685500 ACTTCCCCTCCTGGGCTCTGGGG + Intergenic
948263877 2:236623746-236623768 CCTTGACCTCCTGGGCTCAGGGG + Intergenic
948959295 2:241319673-241319695 CCTTCACCTCCTGGGCTCAAGGG + Intronic
1170756940 20:19212999-19213021 CCTGCCCCGAGTGGGCGCTGCGG + Intronic
1171085263 20:22232686-22232708 CCTGTCCCTCGTGGCCTGTGAGG + Intergenic
1171960830 20:31492849-31492871 CCTTGACCTCGAGGGCTCAGGGG - Intergenic
1171978605 20:31611060-31611082 GCTTCACCTCCTGGGCTCTTAGG + Intergenic
1172916509 20:38447461-38447483 CCTAGGCCTCGTGGGCTGTGCGG + Intergenic
1173549269 20:43921143-43921165 GCTTCCCCAAGTGGGCTCGGAGG + Intronic
1175047087 20:56117264-56117286 CCTTCCCATCCTGTGCTCTTTGG - Intergenic
1175094177 20:56528515-56528537 CCTCCACCTCCTGGGCTCAGGGG - Intergenic
1175286487 20:57840253-57840275 CTTTCCTCCCATGGGCTCTGTGG + Intergenic
1175833785 20:61980964-61980986 CCTTCCCGTCTTGTGCTCAGTGG - Intronic
1176074836 20:63243729-63243751 CCTTCCTCCCGTGGCCACTGCGG + Intronic
1176265338 20:64206327-64206349 CCTTCCCCTCTTGGCCTCCCCGG - Intronic
1176603790 21:8813902-8813924 CCTTCCCCTCGTGGGCTTTCTGG + Intergenic
1176618773 21:9041581-9041603 CTTTCCCCTCATGGGCTTTCTGG + Intergenic
1179575744 21:42307245-42307267 CCTTTCCCTCTTGGGTTTTGTGG - Intergenic
1179794309 21:43773871-43773893 CCTTCCCCTCGGGGGCATGGAGG - Exonic
1180107567 21:45630078-45630100 CATTCCCCTCGTTGGCCCCGTGG + Intergenic
1180135788 21:45861021-45861043 CCTGCCCATCCTGGGCCCTGTGG + Intronic
1180346075 22:11705479-11705501 CCTTCCCCTCGTGGGCTTTCTGG + Intergenic
1180353848 22:11823635-11823657 CCTTCCTCTCATGGGCTTTCTGG + Intergenic
1180355807 22:11838558-11838580 CCGTGACCTCCTGGGCTCTGGGG - Intergenic
1180384400 22:12168690-12168712 CCTTCCTCTCATGGGCTTTCTGG - Intergenic
1181480096 22:23193365-23193387 CCTTCCCCTTGGGGGCTTCGTGG + Intronic
1183238935 22:36641246-36641268 CCTTCCCCTCGTGGGCTCTGCGG - Intronic
1183671243 22:39274170-39274192 CCATTCCCTCATGGGGTCTGCGG - Intergenic
1184115535 22:42419714-42419736 CCTTCCTCTCCTGGGCTTTGGGG + Intronic
1184647393 22:45903582-45903604 CCTTCCCTTCGGGGGCTCCCAGG + Intergenic
1184887753 22:47356775-47356797 CTTTCCCATGGCGGGCTCTGGGG + Intergenic
1185219760 22:49623459-49623481 CCTGCCCAGCGGGGGCTCTGGGG - Intronic
1185294441 22:50046319-50046341 CCTCCCTCTCCTGGGGTCTGAGG - Intronic
949922462 3:9013768-9013790 CCTTCCCCGCGTGGTCATTGTGG - Exonic
950515827 3:13464557-13464579 CCTTGCCCTCCTGGGCTCAAGGG + Intergenic
951132845 3:19068917-19068939 CCTTCCCATCATAGGCCCTGAGG + Intergenic
951432830 3:22628092-22628114 CTTTCCCCTTGTGGACTCTGAGG - Intergenic
952105583 3:30065798-30065820 CCCTCCCATCATGGGCTCGGAGG - Intergenic
953490203 3:43343670-43343692 CCGTCCCCTTCTGGGCTCAGTGG + Intronic
954109369 3:48425510-48425532 CCCTCCTCATGTGGGCTCTGAGG - Intronic
954802668 3:53196131-53196153 TCCTCCCCTCCTGGGGTCTGCGG - Intergenic
955408949 3:58643525-58643547 GCTTCCCCTCCTGAGCTCTACGG + Intronic
958650114 3:96927297-96927319 CCTTCCCATCATAGGCTCTAAGG - Intronic
959357779 3:105354106-105354128 CCTCCCCCTCGCGGGCCCTGGGG + Intergenic
960972568 3:123150251-123150273 CTCTTCCCACGTGGGCTCTGGGG - Exonic
964426682 3:156561568-156561590 CCCTCCCATCATAGGCTCTGAGG + Intergenic
966250808 3:177863396-177863418 CCTTCCCTGTGTAGGCTCTGGGG + Intergenic
968475579 4:805194-805216 CCTTCCAAACATGGGCTCTGCGG - Intronic
968943945 4:3653867-3653889 CCCTCCCCTCGCTGGCTGTGGGG + Intergenic
973374329 4:49277015-49277037 CCTTCCCCTCATGGGCTTTCTGG - Intergenic
973383082 4:49333224-49333246 CCTTCCCCTCATGGGCTTTCTGG + Intergenic
973386687 4:49518240-49518262 CCTTCCCCTCATGGGCTTTCTGG + Intergenic
977339536 4:95741316-95741338 CCTCCACCTCGTGGGCTCAAGGG - Intergenic
980745467 4:137007358-137007380 CCTCCACCTCCTGGCCTCTGGGG + Intergenic
981150700 4:141376814-141376836 CCTGCCCCTCCTTGGCTGTGTGG + Intergenic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
986023652 5:3828935-3828957 CCTTCCCCTGGTGTCTTCTGGGG + Intergenic
986284067 5:6347174-6347196 CCTTCCCTTGGGGGGCCCTGAGG - Intergenic
987379786 5:17274943-17274965 CCTCCACCTCCTGGGCTCAGGGG - Intronic
987837364 5:23178915-23178937 CTTTCCCCCGGCGGGCTCTGAGG - Intergenic
989188798 5:38649875-38649897 CTTTCCTTTCTTGGGCTCTGTGG - Intergenic
992571725 5:78065726-78065748 CCTTCCCCTCGCTAGCTCTGAGG + Intronic
993384927 5:87252126-87252148 CCTTCCCCTCGCAGGCTCAGAGG - Intergenic
996829690 5:127726810-127726832 CTTTCCCCTTGCTGGCTCTGAGG + Intergenic
998394792 5:141811690-141811712 CCTTCCCATAGTGGCCTCTGGGG - Intergenic
999024257 5:148207743-148207765 CCTCCACCTCCTGGGCTCAGGGG - Intronic
1001133302 5:169081566-169081588 CCTTCTCCTCGGGGGCCCTGAGG - Intronic
1002368137 5:178729302-178729324 CCTGGCCCTGGTGGGCTCAGCGG - Intronic
1002385188 5:178860746-178860768 CCTGGCCCTGGTGGGCTCAGCGG + Intronic
1003245042 6:4376249-4376271 CTTTCCTTTTGTGGGCTCTGAGG + Intergenic
1003385139 6:5660562-5660584 CCTTGACCTCCTGGGCTCAGGGG - Intronic
1004805747 6:19201908-19201930 CCTTCCCATCATGGGCCCAGAGG - Intergenic
1005212388 6:23481934-23481956 CCTTCCCCATGTGGCCTTTGTGG - Intergenic
1006535549 6:34696388-34696410 CCTTCCCCTCGGGGCCCCCGAGG + Intronic
1006677844 6:35776873-35776895 CTTTCCCCTGGTGGCCTCAGAGG + Intronic
1006712194 6:36083766-36083788 CTTTCCCCTTGCTGGCTCTGAGG + Intronic
1007178098 6:39909997-39910019 CCTTGGCCTCCTGGCCTCTGAGG + Intronic
1007720982 6:43885383-43885405 CATCCCCCTTGTCGGCTCTGGGG + Intergenic
1007824621 6:44590736-44590758 CCTGCTCCTTGTGGGGTCTGAGG + Intergenic
1009598767 6:65771453-65771475 CCTGGCCCCCGGGGGCTCTGGGG + Intergenic
1013304848 6:108838507-108838529 CCTTCCCCTAGGGCACTCTGAGG - Intergenic
1014177038 6:118342464-118342486 TCTTACCCTACTGGGCTCTGTGG + Intergenic
1017493320 6:154962888-154962910 CCTTCCCCATGTGCCCTCTGTGG - Intronic
1017943175 6:159071351-159071373 CCTTCACCTCTTGGGCTCAAGGG + Intergenic
1018722155 6:166581302-166581324 CCTTCCCCTCAGGGCCTATGCGG + Intronic
1019179151 6:170176293-170176315 CCTGCCCGGCGTGGGCCCTGCGG + Intergenic
1019375410 7:688720-688742 CCTCCCCCTCCAGAGCTCTGCGG + Intronic
1019625134 7:2012072-2012094 CCTTCCCATGGTGGGGTGTGGGG - Intronic
1019943328 7:4308196-4308218 CCTTCCTCCCGTTGGCTCTGCGG + Intergenic
1023030798 7:36089171-36089193 CCTTCCCTTCACAGGCTCTGAGG + Intergenic
1023196815 7:37649840-37649862 CCTTGACCTCCTGGGCTCAGGGG + Intergenic
1023623430 7:42094842-42094864 CCTTCCCCTCTGGGGCTCCTTGG - Intronic
1023865479 7:44236246-44236268 CTGGCCCCTCCTGGGCTCTGTGG + Intronic
1024520156 7:50298585-50298607 CCATCCCCTCCTGACCTCTGTGG - Intergenic
1024925161 7:54604809-54604831 CCTTCGCCATGTGGGATCTGAGG + Intergenic
1025012259 7:55406981-55407003 CTTTCCCCTCCTGAGTTCTGGGG - Intronic
1025140083 7:56455600-56455622 CCTTCACCTCCTGGGCTCACTGG - Intergenic
1025239798 7:57261607-57261629 CCTCCACCTCCTGGGCTCAGTGG - Intergenic
1026586767 7:71661841-71661863 GCTTCCTGTCCTGGGCTCTGTGG - Intronic
1026975122 7:74493191-74493213 CCTTGACCTCCTGGGCTCAGGGG + Intronic
1026975228 7:74493800-74493822 CCTTGACCTCCTGGGCTCAGGGG + Intronic
1032272248 7:130420244-130420266 CCTCCCCTTCCTGGGCTCAGGGG - Intronic
1032401218 7:131625793-131625815 CCTGCCCCTCCAGGGCTCAGAGG - Intergenic
1034447770 7:151122229-151122251 CCATCCCCTCCTGGGCTCCACGG - Intronic
1034554848 7:151843887-151843909 CCTTCCCTGGCTGGGCTCTGAGG - Intronic
1035068142 7:156122688-156122710 CCTTCCCCCTGTGGTCTCTGTGG - Intergenic
1035081476 7:156219841-156219863 CCTGCCCCTCTGGGCCTCTGAGG + Intergenic
1036140405 8:6202282-6202304 TTTTCCCCTCCTGGGCTCTGGGG + Intergenic
1036485701 8:9177021-9177043 CCTTCAACTCCTGGGCTCAGGGG - Intergenic
1036691288 8:10946368-10946390 ACTGCCCCGGGTGGGCTCTGCGG - Intronic
1036703991 8:11032847-11032869 CCCTCCCCTCATGAGCACTGAGG + Intronic
1037600734 8:20391667-20391689 CCACCCCTTCGTGTGCTCTGGGG - Intergenic
1037681287 8:21099743-21099765 CCTTCCTCACCTGGTCTCTGGGG + Intergenic
1038568522 8:28639584-28639606 ACTTCCCCTCTTGGTCCCTGCGG + Intronic
1039516510 8:38138194-38138216 CCTTGACCTCCTGGGCTCAGGGG - Intronic
1040105671 8:43540319-43540341 CCTTCATCTGGAGGGCTCTGGGG + Intergenic
1040848968 8:51878663-51878685 CCTTCACCTCTTGGGCTCAAGGG - Intronic
1045325263 8:101112996-101113018 TCTTCCCCTCGTGGGGACTGAGG + Intergenic
1045502951 8:102757258-102757280 CCCTGCCCTGCTGGGCTCTGTGG + Intergenic
1046814093 8:118565045-118565067 CCCTCCCCTCCTGGGTTCTTGGG - Intronic
1049035058 8:140069252-140069274 CCTTCAGATCGTGGGCCCTGAGG - Intronic
1049529905 8:143148999-143149021 CCTGCTCCTCCTGGGCTCTGCGG - Intergenic
1049613789 8:143567706-143567728 CCTCCCCCTGGGGGGCTGTGGGG - Intronic
1049818641 8:144620884-144620906 CCTTCACCTCGAGGGCACAGTGG - Intergenic
1049936631 9:505701-505723 CTTTCCGCACGTGGCCTCTGCGG + Intronic
1053398946 9:37800882-37800904 CCGTCCCCTCCAGGGCTATGGGG - Exonic
1053495039 9:38543574-38543596 GCTTCCAGTCTTGGGCTCTGTGG + Intronic
1053524083 9:38811076-38811098 CCCTATTCTCGTGGGCTCTGAGG - Intergenic
1054352518 9:64029967-64029989 CCTTGACCTCCTGGGCTCCGGGG - Intergenic
1054760285 9:68998770-68998792 ATTTCCCCTTCTGGGCTCTGAGG + Intronic
1054809310 9:69422228-69422250 CCTACCCCTCTTGGGGTCTTTGG + Intergenic
1057199416 9:93132398-93132420 CCTGGCCCTCATGTGCTCTGTGG + Intronic
1057262947 9:93596229-93596251 CCCTCCACTCGTGGGCACAGGGG - Intronic
1057304102 9:93902576-93902598 CCCTCCCACCTTGGGCTCTGGGG - Intergenic
1057361141 9:94374726-94374748 CCGCGCCCTCATGGGCTCTGCGG - Exonic
1057662220 9:97013438-97013460 CCGCGCCCTCATGGGCTCTGCGG + Exonic
1057838979 9:98469756-98469778 CCTTCCCCTCTCTGGCTCTTAGG + Intronic
1058619780 9:106870809-106870831 CCTTCCCCAGCTGGGCTCTGTGG - Intronic
1060102839 9:120855916-120855938 CCTTCCCTACCTGGGCTCTGGGG - Exonic
1061086830 9:128404561-128404583 CCTCCTTCTCTTGGGCTCTGGGG + Intergenic
1061127627 9:128686895-128686917 CCTTGACCTCCTGGGCTCTGGGG - Intronic
1062025399 9:134338021-134338043 CCTTGCCCTCGTGGGCTGCCAGG + Intronic
1062230303 9:135478919-135478941 CCTTCCACGAGTGGGCGCTGAGG + Intergenic
1203697999 Un_GL000214v1:114929-114951 CCTTCCCCTCATGGGCTTTCTGG - Intergenic
1203551207 Un_KI270743v1:166063-166085 CCTTCCCCTCATGGGCTTTCTGG + Intergenic
1185678188 X:1865807-1865829 CCATCCCCTCGTGGACTCAGCGG + Intergenic
1189320437 X:40083993-40084015 CATTCCCCGGGTGGGCTCGGCGG - Intronic
1190101026 X:47523417-47523439 CCTTCACGTCGTGAGCTCTGCGG + Intergenic
1190385177 X:49878205-49878227 CACACTCCTCGTGGGCTCTGGGG + Intergenic
1192236142 X:69297375-69297397 CCCTCCCCCCGTAGGCTCTGTGG + Intergenic
1194663409 X:96651112-96651134 CCTTGGCCTCCTGGGCTCAGGGG + Intergenic
1195362137 X:104093273-104093295 CATTGCCCTTGTGGGATCTGGGG + Intergenic
1199574110 X:149296915-149296937 CCTTCCTCTCTGGGCCTCTGTGG + Intergenic
1201152475 Y:11101670-11101692 CCTTCCCCTCATGGGCTTTCTGG + Intergenic