ID: 1183244509

View in Genome Browser
Species Human (GRCh38)
Location 22:36683636-36683658
Sequence GATTTACCTCTGGTAGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183244509_1183244516 2 Left 1183244509 22:36683636-36683658 CCTCTTCCTACCAGAGGTAAATC No data
Right 1183244516 22:36683661-36683683 TCTATGCTTGGAAGGCTCTAGGG No data
1183244509_1183244515 1 Left 1183244509 22:36683636-36683658 CCTCTTCCTACCAGAGGTAAATC No data
Right 1183244515 22:36683660-36683682 TTCTATGCTTGGAAGGCTCTAGG No data
1183244509_1183244518 29 Left 1183244509 22:36683636-36683658 CCTCTTCCTACCAGAGGTAAATC No data
Right 1183244518 22:36683688-36683710 GAAAGAAATTCCTTCCCTGCTGG No data
1183244509_1183244512 -10 Left 1183244509 22:36683636-36683658 CCTCTTCCTACCAGAGGTAAATC No data
Right 1183244512 22:36683649-36683671 GAGGTAAATCCTTCTATGCTTGG No data
1183244509_1183244513 -6 Left 1183244509 22:36683636-36683658 CCTCTTCCTACCAGAGGTAAATC No data
Right 1183244513 22:36683653-36683675 TAAATCCTTCTATGCTTGGAAGG No data
1183244509_1183244517 5 Left 1183244509 22:36683636-36683658 CCTCTTCCTACCAGAGGTAAATC No data
Right 1183244517 22:36683664-36683686 ATGCTTGGAAGGCTCTAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183244509 Original CRISPR GATTTACCTCTGGTAGGAAG AGG (reversed) Intronic