ID: 1183244511

View in Genome Browser
Species Human (GRCh38)
Location 22:36683646-36683668
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183244511_1183244516 -8 Left 1183244511 22:36683646-36683668 CCAGAGGTAAATCCTTCTATGCT No data
Right 1183244516 22:36683661-36683683 TCTATGCTTGGAAGGCTCTAGGG No data
1183244511_1183244519 27 Left 1183244511 22:36683646-36683668 CCAGAGGTAAATCCTTCTATGCT No data
Right 1183244519 22:36683696-36683718 TTCCTTCCCTGCTGGTTGACAGG No data
1183244511_1183244515 -9 Left 1183244511 22:36683646-36683668 CCAGAGGTAAATCCTTCTATGCT No data
Right 1183244515 22:36683660-36683682 TTCTATGCTTGGAAGGCTCTAGG No data
1183244511_1183244520 28 Left 1183244511 22:36683646-36683668 CCAGAGGTAAATCCTTCTATGCT No data
Right 1183244520 22:36683697-36683719 TCCTTCCCTGCTGGTTGACAGGG No data
1183244511_1183244518 19 Left 1183244511 22:36683646-36683668 CCAGAGGTAAATCCTTCTATGCT No data
Right 1183244518 22:36683688-36683710 GAAAGAAATTCCTTCCCTGCTGG No data
1183244511_1183244517 -5 Left 1183244511 22:36683646-36683668 CCAGAGGTAAATCCTTCTATGCT No data
Right 1183244517 22:36683664-36683686 ATGCTTGGAAGGCTCTAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183244511 Original CRISPR AGCATAGAAGGATTTACCTC TGG (reversed) Intronic