ID: 1183244514

View in Genome Browser
Species Human (GRCh38)
Location 22:36683658-36683680
Sequence TAGAGCCTTCCAAGCATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183244514_1183244520 16 Left 1183244514 22:36683658-36683680 CCTTCTATGCTTGGAAGGCTCTA No data
Right 1183244520 22:36683697-36683719 TCCTTCCCTGCTGGTTGACAGGG No data
1183244514_1183244519 15 Left 1183244514 22:36683658-36683680 CCTTCTATGCTTGGAAGGCTCTA No data
Right 1183244519 22:36683696-36683718 TTCCTTCCCTGCTGGTTGACAGG No data
1183244514_1183244518 7 Left 1183244514 22:36683658-36683680 CCTTCTATGCTTGGAAGGCTCTA No data
Right 1183244518 22:36683688-36683710 GAAAGAAATTCCTTCCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183244514 Original CRISPR TAGAGCCTTCCAAGCATAGA AGG (reversed) Intronic