ID: 1183244515

View in Genome Browser
Species Human (GRCh38)
Location 22:36683660-36683682
Sequence TTCTATGCTTGGAAGGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183244510_1183244515 -5 Left 1183244510 22:36683642-36683664 CCTACCAGAGGTAAATCCTTCTA No data
Right 1183244515 22:36683660-36683682 TTCTATGCTTGGAAGGCTCTAGG No data
1183244511_1183244515 -9 Left 1183244511 22:36683646-36683668 CCAGAGGTAAATCCTTCTATGCT No data
Right 1183244515 22:36683660-36683682 TTCTATGCTTGGAAGGCTCTAGG No data
1183244507_1183244515 12 Left 1183244507 22:36683625-36683647 CCAAGAAAACACCTCTTCCTACC No data
Right 1183244515 22:36683660-36683682 TTCTATGCTTGGAAGGCTCTAGG No data
1183244509_1183244515 1 Left 1183244509 22:36683636-36683658 CCTCTTCCTACCAGAGGTAAATC No data
Right 1183244515 22:36683660-36683682 TTCTATGCTTGGAAGGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183244515 Original CRISPR TTCTATGCTTGGAAGGCTCT AGG Intronic