ID: 1183244519

View in Genome Browser
Species Human (GRCh38)
Location 22:36683696-36683718
Sequence TTCCTTCCCTGCTGGTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183244511_1183244519 27 Left 1183244511 22:36683646-36683668 CCAGAGGTAAATCCTTCTATGCT No data
Right 1183244519 22:36683696-36683718 TTCCTTCCCTGCTGGTTGACAGG No data
1183244514_1183244519 15 Left 1183244514 22:36683658-36683680 CCTTCTATGCTTGGAAGGCTCTA No data
Right 1183244519 22:36683696-36683718 TTCCTTCCCTGCTGGTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183244519 Original CRISPR TTCCTTCCCTGCTGGTTGAC AGG Intronic