ID: 1183244520 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:36683697-36683719 |
Sequence | TCCTTCCCTGCTGGTTGACA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1183244511_1183244520 | 28 | Left | 1183244511 | 22:36683646-36683668 | CCAGAGGTAAATCCTTCTATGCT | No data | ||
Right | 1183244520 | 22:36683697-36683719 | TCCTTCCCTGCTGGTTGACAGGG | No data | ||||
1183244514_1183244520 | 16 | Left | 1183244514 | 22:36683658-36683680 | CCTTCTATGCTTGGAAGGCTCTA | No data | ||
Right | 1183244520 | 22:36683697-36683719 | TCCTTCCCTGCTGGTTGACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1183244520 | Original CRISPR | TCCTTCCCTGCTGGTTGACA GGG | Intronic | ||