ID: 1183246801

View in Genome Browser
Species Human (GRCh38)
Location 22:36700086-36700108
Sequence AGCGGGGCCTCACTACCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183246801_1183246816 28 Left 1183246801 22:36700086-36700108 CCCGGGGGTAGTGAGGCCCCGCT No data
Right 1183246816 22:36700137-36700159 GTGCGCATCGCACAATCCTTGGG No data
1183246801_1183246815 27 Left 1183246801 22:36700086-36700108 CCCGGGGGTAGTGAGGCCCCGCT No data
Right 1183246815 22:36700136-36700158 TGTGCGCATCGCACAATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183246801 Original CRISPR AGCGGGGCCTCACTACCCCC GGG (reversed) Intronic