ID: 1183246810 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:36700120-36700142 |
| Sequence | GCGCACAGGCACTGTGGGTT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1183246810_1183246815 | -7 | Left | 1183246810 | 22:36700120-36700142 | CCCAACCCACAGTGCCTGTGCGC | No data | ||
| Right | 1183246815 | 22:36700136-36700158 | TGTGCGCATCGCACAATCCTTGG | No data | ||||
| 1183246810_1183246816 | -6 | Left | 1183246810 | 22:36700120-36700142 | CCCAACCCACAGTGCCTGTGCGC | No data | ||
| Right | 1183246816 | 22:36700137-36700159 | GTGCGCATCGCACAATCCTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1183246810 | Original CRISPR | GCGCACAGGCACTGTGGGTT GGG (reversed) | Intronic | ||