ID: 1183246811

View in Genome Browser
Species Human (GRCh38)
Location 22:36700121-36700143
Sequence TGCGCACAGGCACTGTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183246811_1183246815 -8 Left 1183246811 22:36700121-36700143 CCAACCCACAGTGCCTGTGCGCA No data
Right 1183246815 22:36700136-36700158 TGTGCGCATCGCACAATCCTTGG No data
1183246811_1183246816 -7 Left 1183246811 22:36700121-36700143 CCAACCCACAGTGCCTGTGCGCA No data
Right 1183246816 22:36700137-36700159 GTGCGCATCGCACAATCCTTGGG No data
1183246811_1183246818 30 Left 1183246811 22:36700121-36700143 CCAACCCACAGTGCCTGTGCGCA No data
Right 1183246818 22:36700174-36700196 TAACCCTTTACAGACAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183246811 Original CRISPR TGCGCACAGGCACTGTGGGT TGG (reversed) Intronic