ID: 1183246811 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:36700121-36700143 |
Sequence | TGCGCACAGGCACTGTGGGT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1183246811_1183246815 | -8 | Left | 1183246811 | 22:36700121-36700143 | CCAACCCACAGTGCCTGTGCGCA | No data | ||
Right | 1183246815 | 22:36700136-36700158 | TGTGCGCATCGCACAATCCTTGG | No data | ||||
1183246811_1183246816 | -7 | Left | 1183246811 | 22:36700121-36700143 | CCAACCCACAGTGCCTGTGCGCA | No data | ||
Right | 1183246816 | 22:36700137-36700159 | GTGCGCATCGCACAATCCTTGGG | No data | ||||
1183246811_1183246818 | 30 | Left | 1183246811 | 22:36700121-36700143 | CCAACCCACAGTGCCTGTGCGCA | No data | ||
Right | 1183246818 | 22:36700174-36700196 | TAACCCTTTACAGACAACTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1183246811 | Original CRISPR | TGCGCACAGGCACTGTGGGT TGG (reversed) | Intronic | ||