ID: 1183246812

View in Genome Browser
Species Human (GRCh38)
Location 22:36700125-36700147
Sequence GCGATGCGCACAGGCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183246812_1183246819 27 Left 1183246812 22:36700125-36700147 CCCACAGTGCCTGTGCGCATCGC No data
Right 1183246819 22:36700175-36700197 AACCCTTTACAGACAACTCAGGG No data
1183246812_1183246818 26 Left 1183246812 22:36700125-36700147 CCCACAGTGCCTGTGCGCATCGC No data
Right 1183246818 22:36700174-36700196 TAACCCTTTACAGACAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183246812 Original CRISPR GCGATGCGCACAGGCACTGT GGG (reversed) Intronic