ID: 1183246813

View in Genome Browser
Species Human (GRCh38)
Location 22:36700126-36700148
Sequence TGCGATGCGCACAGGCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183246813_1183246818 25 Left 1183246813 22:36700126-36700148 CCACAGTGCCTGTGCGCATCGCA No data
Right 1183246818 22:36700174-36700196 TAACCCTTTACAGACAACTCAGG No data
1183246813_1183246819 26 Left 1183246813 22:36700126-36700148 CCACAGTGCCTGTGCGCATCGCA No data
Right 1183246819 22:36700175-36700197 AACCCTTTACAGACAACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183246813 Original CRISPR TGCGATGCGCACAGGCACTG TGG (reversed) Intronic