ID: 1183246815

View in Genome Browser
Species Human (GRCh38)
Location 22:36700136-36700158
Sequence TGTGCGCATCGCACAATCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183246808_1183246815 10 Left 1183246808 22:36700103-36700125 CCCGCTGGGGAGAATGGCCCAAC No data
Right 1183246815 22:36700136-36700158 TGTGCGCATCGCACAATCCTTGG No data
1183246807_1183246815 11 Left 1183246807 22:36700102-36700124 CCCCGCTGGGGAGAATGGCCCAA No data
Right 1183246815 22:36700136-36700158 TGTGCGCATCGCACAATCCTTGG No data
1183246811_1183246815 -8 Left 1183246811 22:36700121-36700143 CCAACCCACAGTGCCTGTGCGCA No data
Right 1183246815 22:36700136-36700158 TGTGCGCATCGCACAATCCTTGG No data
1183246801_1183246815 27 Left 1183246801 22:36700086-36700108 CCCGGGGGTAGTGAGGCCCCGCT No data
Right 1183246815 22:36700136-36700158 TGTGCGCATCGCACAATCCTTGG No data
1183246809_1183246815 9 Left 1183246809 22:36700104-36700126 CCGCTGGGGAGAATGGCCCAACC No data
Right 1183246815 22:36700136-36700158 TGTGCGCATCGCACAATCCTTGG No data
1183246810_1183246815 -7 Left 1183246810 22:36700120-36700142 CCCAACCCACAGTGCCTGTGCGC No data
Right 1183246815 22:36700136-36700158 TGTGCGCATCGCACAATCCTTGG No data
1183246802_1183246815 26 Left 1183246802 22:36700087-36700109 CCGGGGGTAGTGAGGCCCCGCTG No data
Right 1183246815 22:36700136-36700158 TGTGCGCATCGCACAATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183246815 Original CRISPR TGTGCGCATCGCACAATCCT TGG Intronic