ID: 1183246817

View in Genome Browser
Species Human (GRCh38)
Location 22:36700153-36700175
Sequence TAGAATTGCAACACTTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183246817_1183246819 -1 Left 1183246817 22:36700153-36700175 CCTTGGGAAGTGTTGCAATTCTA No data
Right 1183246819 22:36700175-36700197 AACCCTTTACAGACAACTCAGGG No data
1183246817_1183246822 6 Left 1183246817 22:36700153-36700175 CCTTGGGAAGTGTTGCAATTCTA No data
Right 1183246822 22:36700182-36700204 TACAGACAACTCAGGGAGAGAGG No data
1183246817_1183246818 -2 Left 1183246817 22:36700153-36700175 CCTTGGGAAGTGTTGCAATTCTA No data
Right 1183246818 22:36700174-36700196 TAACCCTTTACAGACAACTCAGG No data
1183246817_1183246823 7 Left 1183246817 22:36700153-36700175 CCTTGGGAAGTGTTGCAATTCTA No data
Right 1183246823 22:36700183-36700205 ACAGACAACTCAGGGAGAGAGGG No data
1183246817_1183246824 21 Left 1183246817 22:36700153-36700175 CCTTGGGAAGTGTTGCAATTCTA No data
Right 1183246824 22:36700197-36700219 GAGAGAGGGAGTGTGCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183246817 Original CRISPR TAGAATTGCAACACTTCCCA AGG (reversed) Intronic