ID: 1183246818

View in Genome Browser
Species Human (GRCh38)
Location 22:36700174-36700196
Sequence TAACCCTTTACAGACAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183246813_1183246818 25 Left 1183246813 22:36700126-36700148 CCACAGTGCCTGTGCGCATCGCA No data
Right 1183246818 22:36700174-36700196 TAACCCTTTACAGACAACTCAGG No data
1183246817_1183246818 -2 Left 1183246817 22:36700153-36700175 CCTTGGGAAGTGTTGCAATTCTA No data
Right 1183246818 22:36700174-36700196 TAACCCTTTACAGACAACTCAGG No data
1183246812_1183246818 26 Left 1183246812 22:36700125-36700147 CCCACAGTGCCTGTGCGCATCGC No data
Right 1183246818 22:36700174-36700196 TAACCCTTTACAGACAACTCAGG No data
1183246814_1183246818 17 Left 1183246814 22:36700134-36700156 CCTGTGCGCATCGCACAATCCTT No data
Right 1183246818 22:36700174-36700196 TAACCCTTTACAGACAACTCAGG No data
1183246811_1183246818 30 Left 1183246811 22:36700121-36700143 CCAACCCACAGTGCCTGTGCGCA No data
Right 1183246818 22:36700174-36700196 TAACCCTTTACAGACAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183246818 Original CRISPR TAACCCTTTACAGACAACTC AGG Intronic