ID: 1183247983

View in Genome Browser
Species Human (GRCh38)
Location 22:36708707-36708729
Sequence CACCCACTCCTCTCCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183247983_1183247991 30 Left 1183247983 22:36708707-36708729 CCAGCCTGGGAGAGGAGTGGGTG No data
Right 1183247991 22:36708760-36708782 TCCCTGTGTTCATCCTCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183247983 Original CRISPR CACCCACTCCTCTCCCAGGC TGG (reversed) Intergenic