ID: 1183248980

View in Genome Browser
Species Human (GRCh38)
Location 22:36714906-36714928
Sequence TACACGAGAATGCTCAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183248975_1183248980 26 Left 1183248975 22:36714857-36714879 CCTCAGTATAGAATTTATGAATT No data
Right 1183248980 22:36714906-36714928 TACACGAGAATGCTCAAGAAAGG No data
1183248979_1183248980 -8 Left 1183248979 22:36714891-36714913 CCTAGGACTCTGTGGTACACGAG No data
Right 1183248980 22:36714906-36714928 TACACGAGAATGCTCAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183248980 Original CRISPR TACACGAGAATGCTCAAGAA AGG Intergenic
No off target data available for this crispr