ID: 1183251196

View in Genome Browser
Species Human (GRCh38)
Location 22:36731687-36731709
Sequence TGGACTGAGCATGAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183251196_1183251200 -2 Left 1183251196 22:36731687-36731709 CCATCCTCCTCATGCTCAGTCCA No data
Right 1183251200 22:36731708-36731730 CAAAGCCCTGCAGTCATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183251196 Original CRISPR TGGACTGAGCATGAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr